Description :
From Genome Similarity Track
Location :
Scaffold_40:347964- 358743
Transcript NameFunction/comments
Phyca_LT153418770haustorium-specific membrane protein, putative
Phyca_LT1534535691conserved unknown protein
Phyca_LT1534551095predicted protein
Phyca_LT15349665PREDICTED: GRB2-related adapter protein 2

Sequence
10779 bases(100 bases per row)
aattatctctatgatgctgcacagcacttttacatcttgacaacaaactcagctaacattcagctttgcagtaagctctagattcccaccttgacttgat
cgagggatccacaacagcaaagatccacctcctgttcctggaagaccaagtaatccaggccgccaccgatccagatacagagttttccctcccaatgccg
tcacatttgatctccacgttacagtcttccctgcacggacggtcacttcgtcaatcttgtgtccgccagacctaatattcacagccacgtccttcgtgtc
gacactttcaaacgtgatcttgacgctcccatcgcctttcttcttccaaaacccctcactattgttgaaagctcgttgcacagtggacatccccagtgct
tttttcgcatccccgtcatcgatttccccaatgtactcagtcggtccacaaatcggttgaaaatactcagaaatcgctccggtagcagaccacggatccc
aaatcgcccagaaactgaaagctttgtccgcaatggtaaatgcgtattcctcagccttgagatacgacccgttactgctagttcccgacttgatcagatc
atccacgatacctccaaagtctttcgaagcgtgtcacgagtggcaaatgccttcgtctcgtccgtttgttccagtagttcgctcatacaattattcgttg
cgatagggatgtcgttcagcacgagatttgacttactaaccgctactcgaatgtcgtcctcagacatctgagggttctgctttcggtattccaccacagt
catccacgtccgatccagaatcctcttcatgtcgtatccacacgtggagttggattttagcgcagatttcagagaggaaatatccgtcgagcgcaacgag
tccagtgaatctcccaacgtcatgttcttcatgaatccggtgaatttttcccaactcgaaaggatagtagctccattggcaaccacctccttcaaacgta
ctcggaagtcattattacactgtcgacgaacttgatctcgtccgacgcatagctaccgatacaataggacacggcgatggggatatcgaccacgacgttg
tctgtctgataaagcatcgccaatattttatcttccggagtctgcgggtctgtaactttaatattccgaacatatttcgccagcgccttgatcaatccca
tcgtgtatttagcgcacttgatagccacttgaacagcacgcgccagcttcgacagcttcccgaatacgtcgtacgttatgaaagacagcgtcgtttgagc
cagagcggagactttggtcacaatttccagcgcacagtcatcgttctgccggatacactccattccacactggacagggtaggcgtagggacattgcgcc
cagcacgtcccgagcttgcggttgtagcctaccggacacgtcttggcgatgtgagtcttccgataacacgcagtgactttcgaagtatccagcgcagtgc
caacccaattaacgtacgaagattcgatcgtactagtggcattaagcacaccaccaaactttaaagcggccaccatagcgttggagagagcactcgaagt
tgtcgattcatcgctatcatcgtctctctcggaggcgtcttcggcactggctgaacggctaaaggagtgacttggatcgatgctgtcggtggaatcgcta
ctgtctgtcaggtcactatcgtcactgtccaaagaatcgattgagtcatctgattctgtcgctgttggtgtgttattcactttccaattgattgcaggag
atgccgttaatccggtcgtgggggctctgtttaactcgtaaatgctcgacgctgtttgaccacgagaaactgtggaggctaatagcacgatgaataacct
gagtatcatcggggttgttctgaacacggcaaaacgaaaaatggagaagtcgaacctcagaaaaaggcaaatcttcattctagtcgcagacagatcatcg
gaatggggctagacgggggtatttctccgttcagtgttgaacacggctcaagtctttcccgtgttttagccatctggtcgcggccaaatatcattcgccg
tggcgtggatgatgtctccgccattcaattcgctgttggagagaatctcctgcctgccagagacaccacacactgtggcgttgtttcggccgagatgcga
ccgaggataagccgcttttgagaaacacaacggttgttatcattaaaatatgcatcgactataatacggctcttgagaacttgtattaattcaggtttgt
acatgtagtagagcttttgagattaattgtcgccattggaacatggctgagtgatcgcaagttgcgatcattcgtcaaaggatttgaggaactcgagatt
caattatcgtacagtgtagtattggatcaaacttacgctcgctctatcagaatacgtattttattttgttctacagaaaaattttcttaagctaggtact
tgacttcagctcacattgagcacggcagtaaggtcgaggcttccttgtgtagaatggggaacccacagcaacaacgaaccgcctcctgatccaggaagac
ccagaaaacccggtcgccatcgatccagatacaacgtcttccccgctagatccgtcacatttgccgtccacgttctgcttttgcctgctcgtactaacac
ctcggcgattttatctccaccagacctgatattgacacttacatcctttgtatcgacgctcttgaagttaatggtgacaataccattgccatttttggtc
cacataccgtcactgttgttgaaagctccctgaacggtcttcatccccaacgctttcctaacatttccgtcgtcaatttctccaatgagttgtgtagggc
cacaaatggactgcacaaactctgagatgaccgacgagacgtaaaacggatcccaaatggaccagaagccgatcgctctatctgcgatcttgaaagcgta
ttctccgaaacgaagcaacgtgccgttgttgctcgtccctgcactgactaagtcgtccacaatggctgcaaaggtcttgcgaagagtatctcgcgtggcg
tacgccgtcaattcatccgattccgccagcaattcattcatacagttgttcgtcgcgatcgggatgtctttcaacacgagattcgagtggctcatgacca
ctcggatgtcatcttcggagatttcggggttgagtcgacgcagttctgccactgtcatccacgtccgatccagcagacgcttcatatcgtagccacaagt
tgtgttggacttgagagccgacttcaaagaggtgatatccgcgtcacctaacgaggagattgaccctcctagcgtgatattcttcatgaaattcgtgaat
gcactccagctggaaacaatggccgctccgttggttatgatatctcttaacgcgtactccgcagtcgtaaggacactatctgcaaatttcacgtcgtcag
aagcttttttaccgatgcagtacgagatcgtcaccggaatgtcaataattacgttgtcaatctggtacaaaatggccaggagcttgtcttgtgtcgtttc
cgggtcgtgaactttgatgtagcggatgtagcggaccagggacttggtgatgctgatcatgtacttaatgcatttgaccgccacttgaacgcttcgtgcc
catttggtcatatctccgtatacactccaagcagagagcgatatcgccgtctgcactacgacagcgactttatagaaaacctccgccccacagccatcgt
tctgccggacacactcgagtccgcaggcaaccggatacgaatacggacactcagtcaagcacatcccgaatttgtcttcatagcctagaggacacatctt
agcgatgtgagctttgcgccaacacgcacgggagtacgagtcatcgagagctattccaacccaattgacgtacgtctgctcgatcgtgctggtcgcgtta
agcacactgccgagcttcaacgctgcgtttaagacgtccagtgtggatgccgagccgtcctcactgtcactcgaaacatcttcgctgctgtcgtcggagt
cgtctgcatctcgctcggttgtgtcgtcgctatagttaaatggcatcgagctccgttcacttccattgctttcagcagctaacagaccagcagggactac
tggagagagaggcgttgactttaatccagtaccgaacgtgtaaaccttggccattgatgctccattgaagagaacagtagaaacagctagcagtcggatt
accttgatggaaatcatcggttaagctcttagtaggtaaattcaaaaatgacgagacccacaaacttcaaatcttgtcagtaccaccggcaaaagattct
tcagggtttaacgagcgacgtgggccatcgggacaatactgagcaggcactgcttccaatcacttgtatgattattgttctgtctcgttgagcaacaagt
ggggcggcacctgacaaacgtcgtgacgtaagagattttaagattcaaagagggattggacgaatgatcaaccaccaccacaggttgctagtttcctcgc
tagtcgaccatggctctcctttcaattggttctgtagcaaaaaggtattcataccctaaaggattaacccttataaatatggtgtggggcacataattag
acaaagtattatcatcgccacacatatccgctgcatagatagaggagcattatggtgcaggtcttgatcggggctctgcgtgctgcaggccgccgcgccg
ccgtctctaggttcctttccagccacattatgctgcgaactgcttccttcgctactcagtccagtggtacgcggacctgaacctatattttgatagtcat
aattgtttggcctctctcctaattaatcttttttattgtttttttactgcgtagtatacacatggggcaatggcacattagggcaattgggccacggacc
tgtagtcaaatcaggcatccgtaatgcgtacgaagagctgacgcctaagctggtggaggccttcgagggtaagggcatcactcatgtcgagttcggagcc
agtcatagtgctgccagtacgtcagtcgttaattgttttatgatattcaaacgaacagtagactgacaatgatatttgattgatttattacagttgacga
ggaaggtcggttgttcgtatggggcagcaacgagtacagcaagttgggcctcggagaaacgagcgacgtagaggaactcccgcgtgaagtggaagcgctc
aaaggcattaaaattgtggatgtttcctgtggtgattactttactgcggccgtggatgaggacggcaagatgtactcgtggggctggggaggttccacta
tgaaaggtgcaggaggtcttggtcatgccggaggaaaagacgagcccacgcctcgactattgaccactttggtggaccagggagtgcctattgccacggt
cgagtgtggtgagttccacacggtggcgctcactaaggacggtgagatctgggcctggggtaatggcgagtacggccgactgggcaacggcgagtctgac
acgtgcgaggtgcctgaacccatcgagtttttctccaaggacaacattgtgtctatcgctgctggacgtgacttctcctttgctttgacggataatgggg
agctctacagttggggaggcaacagccgtaagttgattccagctttcttgacgaaatatggagtggtattgatagtttgttttgtggtggatacagagaa
ccagttgggtattggaggtggtttggccatggacgtgtacaacatcgagtccattcctgtactagtggaggccttcagcggtctgtctgtgaagcagatt
gcagctggatacgaccacgccgccgctgtgacggaggacggacgtctgtatatgtggggtgccaagatctggatcgagccgcacgagatgacggccgtga
acgagcacaaggtggtgcaagtggcttgcggacggcagtacactgtgcgttgacggacgacggcaaggtgtttacgtttggcaagggcagttccaactgt
ctgggccatggtgaccgcaagaaccagttgcaaccggttcagatccaagctctggccgatgttaacatcacctcgtacgtaaattggcaatcgaaaaggt
ggggcaaaagaatgagaaacgctaatttgtcaactgtttactgtgacacagggtttcatgcggcgactaccacatgggcgctatcgcgacaccccacgcc
gaggctgccgacaaagatttttccttccgggagtaggaggcgaggtccagtagcttcaatgtaagccgtgcgggataatggtcatggtcaaagctgatgt
tgttgcttcaacctgtttacgctggttggtttcccgtcgtgtcatccgtcgcttccgatctttttcgcgtcccacttaacgatctttggatgatgatgat
tcgcttcgtgttgctgttgtttgtggcagttctgccgtggttgctgctgtgtgagattccgtctgaggtgaaatcgctgctgagctggtggaaaggaaga
caagaactcgcctttagcctggagacgtggccggagccagacatcgacacagatgagtgtatgacacgctaccgagacgccaagtacaacgagatctgcg
tcatcagccgctagaacgagaacccgtagctgacatcaagtgaacagtaagaaattatcgcttttacttgccgtcacgcttgcgtttaaggttattgcga
ctctgcatgacagcggagcccgtgccgtctgatgctacgacgtctgtgaccacgtacggagcttgagcaggctcctgcgcagataaaagaatgctatcga
gcgacatactactgcgcaccagcaagttcacacgtttcaacactgagagaggcagcggacttaggataaacaactgacgtctctcagcgtccagagctcg
aacgatcccaacaccaagacacggagcgtgcacaggctgcagaacgatccgtggaggtccttcagtctcgtcttcttctcttggtttgtactggggattg
atacagagacccacgacgcaggcgttgagagaaaagaggagctgactaggagccacagacgcaccggcaaacgaaacatcgacgtggtcgaaggacacag
tgaaaggagtgagttgtgcgtacgcgcggtagatgttgccgtccagacggttcttttccgacagaacttggagattctggagctgggcccgcgggagaac
gcaacgagatcgagagaggaagtatgagtggaagcgatacgtccgcagctccttggaactacgaggaggttgcgtcacgcccacggggtcccaaggcggc
acggcgtgcagacgccatttaccttctgtggggacgtcgaactgtttgttcttggtggcggccaccagctgcacgacgtggtcgggatttgtctcctgga
tgacgttgcacagcaggtcgtggcccatgctcttgatccacccgtccgtattgataaccagcggtacgttcgagtctttggccccccacttgacttggta
caggcgaagcaggctcttcaccgccttcatgtagtatagagggtcattgcctgggtttgcgttaccacagaagaatgaccggatcgggttcttcatgtgc
gagaatcctggaccgagcagcggcgtcgtcaacgcgtggagcgccaccagtccggacggagtgagctcactctgtcccaagtcagtatccaggaaggcaa
cagtgccgaacttggccagcaaccggttcacaaggaatctgcagaacgtcgacttacccacacctttgcctccgcacacaacgatcttctgcgacgccgc
gttctccgacagactcgactgcaatctgtccgctgtcgcttgccaatgatcagtaaaactcaaagtcttgaaggaatccacgaccacaagctcagcaaga
actcgttccggggtcttccaatcgtgattggatggatctgcatctaatggagcagcacttgtgcagtcaaatccggctgtaagcacactcaagacgtcct
ggttgtacttcgagatgatcattttgaagcctggaagtacggccgtcgacttctcaggtcgtgtattctcatagaaactcgtaatgttcccgtaggtgac
agggatggcgcgtagcaccaacacaatagggaactcgtccacgagttgcatggccagtttgtccgctgcgatctcctcgtcctcatttacagcttccatg
ggtaaattcggctccataacttgcaatagactggcgttcgtaggtccgaaaggtgattgtgtgtcttcgtttcctggtcggccttcaattacaagcaaac
tgctccatttgggcgaatgcaaagagaaatacacacccagaggaggtcggaatcccaacacctcgacgttcccctggaagacccggaagagtgtcatacc
ggcgcaattgatcgaagcagagcgctgcatccccagtgcgacgacattgcctgagcgcgtgcttagtgcacggaacagcggcgaagacagcgcgtctcca
gctgcaggtccgtagtgcgagatgtccgccatcacaattagaatgagtggctagcagttaatttgagggagttttcacacgtcacaggagcttaaatgag
gatgtccgcctaacatgacggtcatttggtaaggtgctaaatgcagccggcaggacgtaagttattttcgagggggtcgtctgatgataacagccgacta
tctactgagtagcagtactgcaagctaaaggctcaacgagtacgcggtggtcgagacatgttgccggcactcaccaccaagccaaagcaggcggtgcgtc
aggttaaaggtttgacgaatgactcgatcgattcgtattcgaacacgccactgggcggtggttctgggctggcagcctcgtacgtggataataccgagtc
gggcaatggaacagcacggtcacctccagcttcaagtagagcaatagttaataatggacaagcgaaagctacaactgaggaaggagtgacgatggctcgt
gttgtgagggaccgaaaagcatcaggtgaagaggaattatcactacgtacgggtgacatcgtcaaagttctgtcttccaagcgtacagggtacctgaaat
gtgaagctggagacgaagtaggctacgtaccgtcgtcgtatttggagttcctagacagcttcgaagagaatgggaatgctgtggctgatgaaagtcagcg
agcaggtgagaaacaacgcaagaaggtaaaagaaaagcggaagaaggagaagcgggaagttaatgatgctagtgatccagaggaagcggttgtactgacc
acccgttcacctcgtaaagaagtcactaacactgaagagaacggcaatgaatcacctcgcaagaggaagaagaaagatcgcaaacatcgcgatcgggacg
caggtgaagaaacagcacgaggagcagtagtggaggaacctcctagtgccagatctcgaactgtacacgaagacacggaacggactcgtagtaaaagcaa
gcattcgaagaagaagcaccaccgtaatgtagatagcagtgcttcaagtgacagtgatggagggaaacgtagtgctcgtcatagccgacgtcgtcgccat
cgacgcgggtcaagtgcgagtgattccgatttaacgtcgtctgacgactcggacgggagctacagacggagacgaagacgtcgacgccacagacacagac
gcagctctagcgaggatgaggatgaagacgatagcgactacaagcaccgatctcgacgcagtagaaaacgtcgtgatagagcgaacgggggttcggagct
tgaagaaaactctcggaaggctgagaagaaaaagatgtcgacaactatgcaagaggttgagaaaggagtgagcaaactcgacgtcaaggctgaagaaaag
gcgccggaagcaaagcctatcgcgtcgtcacgtaagaaggaggagccaagtcaagacagagggaagaaggaagagacagaacggagtgaaggttcttcag
aaggacgcgcgactaacgtatcatcgagtcgaaaagatgacgaaggccgaaccagtaccaacacatcgtcctcacacaagcaaagcagtaccaagtccgg
tcttggtaggcaaatcggtgaaaaaatgcggtcgttcttgggcggtggtagtaagaaacagaacggtggcaagagttcaagtggaattctgaatgcgtgc
ccaggtactgtacagggagaagaaggatggtacgagcatggcgagaatgaacgctactacttcgttcttgtggatgggaagtggagtcttctgtatgggc
ccatgactgaggacgacttcgaagtatattctaaccgggtatgtggcgaacaaaatgccttgatcaagtcgttgtactaacgtttatttgtaggtgtcgg
agcaaaatcgtgctattgagctgccgccgacgtatctgcacaaggctggatactacctcaaccgagaactgcgtgtgcagaaggagcagtaaacaaccgt
agtgctgcaacttatatcaaatttatcaacacgaaagtaccagtacacttcattcattaaggtctcacttagtctaaggcttcgagtttccaacaccaat
tcggtcaacgatggaggggtctgagcttgccaaccactgcgttggagatcttaacatctcctttagttaatcacttagc