Description :
From Genome Similarity Track
Location :
Scaffold_146:34796- 36732
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_146-fgenesh-gene-0.5CREG
Pytap_DAOMBR444maker-pag1_scaffold_146-snap-gene-0.34Phosphatidylserine synthase

Sequence
1936 bases(100 bases per row)
ACCTGGAGAAGGATGCTCGCGCGAGTCTGTCCATCTCGCTGGCTCAGGAAGGTGAACACGCGTGCAAGATGGACGTCGAGGACCCcACGTGTTGGAAGAT
CACGATCATCGGACgTGTTGtGCCCATCACGAGTGAAGAGAAGGAGAAGTTTGCCCTGCAGGCGCTGTTCTCTCGCCACCCACAGATGGCGATGTGGCCA
CGTGGACATGGCTTCAGCGCGTACGTCATGCAGATCGACACCATGATTCTCTTTGATTACTACGGCGGGGCTAAGCACATcAAGCCGGCTGACTACTACA
ACATCAAGCTCACAGACGAGTAGATGACTCTGTAGGGCTCTCATATATATAaGCTAaCACGTTCGTGCGcAaTATGTTCTCATCCATGTTGTTCGTCTCC
TTCCAGTCCTCGAACTTCAGCGAGAATGGGTGAATCTACTAtGTAGTAGTAaTAGACAACTTATtGGATGAATGATCTCTATTCATGTGTTGCTCTACAA
ATTCAATCAGTAGGCCCACTGAGTTGTGAGCACGAGCAATGGGGTGAATGAGAGCCAGAAGAGCACATCCAGCAACCCCCACGACGTCACGCGGCCATCC
GTTGCCTTACCACGACGCTTGGATGACACAGGAGTTCTCGGCCGAGGGCCCGAAAAGAAGAGAGCCATCCACACGGAAAACATTCCGAGGAATGCCAGAA
TCGGATACAAAACTTCTGGAGGCGGCGCATTGGTGAACAAAaTGCCGGGGgAAAaCTTGACCCATACAAGGACCTcGAAACTCGCGATAGACAAAATCAT
CCAAGCGTTCTGACCGAGACGCCAGCAGTCGGGGTTCGTGAGGAACTCGTAGTACTGTTTGgCAGagAACCAACAATGAGAGACTGAGGCATTGATGCCA
GAATTCGAACGAAGAACATACCTCTGCGGCTCCTTGCACACCAATAAGGAACATCAACGCAAGGCGGTAGGCGTTGAAGTTGCTCTCTTTTGGAACGCTC
AGGGTGTTCAGCAAGAAGAAGGCATTGAGCTCCACAACAAGACACACGATCAGAGCAAACATGATCTACACaCAAGCAACGAGTGAGCACCAGCTCTCAC
ACGCGGAGGATGTCAGCGAGGAAAGCAGCGTACCGAGACAAACCGCTTGAAGTTGGAGAAGACTTCCCAGTCATACTGGGCCCAACTGATGGGGGTGAAT
TGGCTGAGAGCGAACAAGACCGCCCCCATCTTCTTGCCCTTTTTACCAGACCAGTCGTAGATCTTGGTCTCAAAGTACTTGAGGGTCACACTTCCGAGAA
TCATGCCGAGCAGGTTGGCACCCAGCAAGTCCATGAAGAGAGAGTCCCACCAGCACTCTTGGAAATCAGGAATGACAAACTGAAACGCCAACTCGAGGAT
CTCGAAGGCGATACTGAGCACCCAGCAGAATCGCCAGTCGCGGAACATGCACATCTTGCCCCACCACCCAGTGACGTGGGCAaGGAACCAAATGCTTGAG
ACGCCACGGTACAGCGACGTCGAGTTGATCTCGCACTCGAGCTTCTGGCCCAGCGGCGTCATCTTCTtGGGGgtCCcAACCTCAGGGAAGAAGAATTGCA
TGCTTGTGATTGCACCGCGGCGGTTCTGCACGGACATACCCACGAGCAGTAGCAAGTACACGACAGAGCAGCCATGCACAATACGCCACACGCctGGGTG
GGGgCGCACCATGAGCCCATCGCGCGTCTGCAGGAAGCAGTACACAAGGAAGATGAGCACACCCGcGCTCATTCCCGtGCGCACATTCtCCACAAGGTCg
TCCGAGTCGTGCGTGAACGAGTAATACGACACAGCCATCACGACGAGGCACAGCACGAAGAGCTGaCGCGGCTTCTCCCGGTACAGCAGCATGTCCTCGA
CGGCTTCATTGCCTTGAGCAGTACGGAACATGTTGT