Description :
From Genome Similarity Track
Location :
Scaffold_47:347918- 352765
Transcript NameFunction/comments
Physo_136687reverse transcriptase

Sequence
4847 bases(100 bases per row)
TGAAGATCAGCATCGCCAGGCCTTTTGGGAAACCACTCATTATCTCCCGATCACGGCCGCACAGCGTCGGGACCCGATCGTTGAGCAATACCATCGCGAT
CGTCGAGCCCGACGGATCCGCCTCGGTGATCGGTGGCGCCGGCTCTTCGACGCGATGCTGCCCATGATGCGAAAGATGTGGGCAGACGTCGATCTGATGC
TGGACCTGTTCTTCTTGCAGATCCCGGTGCGACAACGGGACGCTGTGACCTGGTACCCCGGTGCGGTGTCTCGCGCTGCGAATGCTGGCGACCCCACCCA
GCACCAAGGTGAGCCGACCGACCTGTGAACAGCCCTGATCGAGGCCGACACCCATGACCCCTGGCGGAACCAGTATCGCGATCACCGCCAGGACCATCCA
GCTCAACGGATCCCGCGCCTCCGCAACAAGTTCAACCCCAACGTCGGCGCCCAGTACCAGCCATGACGTGATCGCCGTCTCTGCGATCGACTTCCGTAAG
TAGCGAGCCAGTCGACTATTACAATCCCAGAGTCGGAGTGACTCGGAGGCCGATCTTCCATACGCGTAACGCGAAATATTCAGATTAATCCATTCCATCG
TAACAATCCACAATCTTCCTCGATCTCCCACTGTTCCCCGTCAATCCATTCGTTGCTAGCTCGATCGACCAAGATCTGTCCTCATACCTTCCTGTACTCC
CTCCATAACCATCCGATCTGCACAGACGTACACACATTCATTCATATACAACCCCTTCCTCCGACCAACGGCCTCCCCGTCGATCCGTCATCCATCTCGC
TCACCAAGGCGACCAGCTCACCCTGGCGGTCCGATCTCACTCCTCCTCGTGAGACTGCATCGCGCCAAATCGGTTCCGGTTCACGCGATCTCGAAGGAAC
TCGTGCAATAACGCTCCACAGTTGAGATCAGCTTCGTCGACCCAGTCAGGCTCGTCGTAACCCTTCCAGCGTACTAGGAATTCTCGATAAGTCCGGCCGT
ACCGCGTCCTTCGACCCGTCCGTATCCGTGATCTTCTCCACTTCGTACTCGTTCGAGTCTCGATCTGGGGTCCAGCTGTCCTCCGAAAGTAAGACTTCGA
CGAAATCAAGTCGATCCGCTTCGTCCACCGTGAGCGCGATCTGCGGTCGATCGGGGAAGTCCCTGACCAACTTCAGCTTCGAAACATGCACGATCGGGAA
AACGTGATAGTCCGTACCAGCGATCTGAAGCTTCATCGTGTACTCGTTCACCTTCTCCGCAACACGGAACGGGCCGTGCCACAGGTGAACCAGCTTCCGG
GCATACCCCTCTTTCACACGATCCAGGTACAGCCACACCTGAGATCCAGCCTCGACCGAGTGCGGTCGAACTTCTTCATTATGTCGATCGGTCCGATCCG
CGATCACCTCGAGTAGGCGAGCATTCACCTGACTTCGAGCCCGATCGTAGAGTCTCTGGATCCGATAACGCCACCGTCTAGGATTCCGATCGCGAGTCTG
AGTACTACCCAAAGGTATCGTCGCCTCGAGCGTCGATCGGGGATCCCAACCATGCACCAGATAAAAAGGGGAGTCTCCACGAACTCGATCTTGAGCCGTA
TTGATCGCGAAGGTTAATCGCTCTGCGTACTCATCCCAATCTCTTTGATCCAGATCCTCCACGAACATCTTCAGGGCTCTCGTCGCCACCTGTACCATTC
ACTCTGCAGTACCGTTAGCTTGAGGTCGATATGCCATCGTCGCTCGCTGACGCATACCCAGGATCTTGTTAAAGGCACGGAAAAAGTCGGCCATAAATCC
CGGTTCGCGATCATGCCTGATCACCTCGCTAGCACCAAATCGCCGGAATACGCACTCTTCGTAAGACTCGGCGATCGTCTGCGCCGTTCTGGACGAACTG
GCCTTCGCGATCACGTATCTCGTGAACAGATCGACCCAGATCAACAGTTCCGTATTGCCCTTGTACGACTTCGGCAGCGAAGGTATGTGATCCATCGCTA
TGATCTGGAACGGGTATGTCGCCTGGATGTTCCCCGGCGACTCGCCCCTGATCGTGGGTTGTCCTTTGCCGGCCTCACAGTCGACACATTCACCGACGTA
CTTCTGCACACTCCTGAAGAGACCTCTCCAGTGAAAGTGATCGCGGATCCGCTGATAGGTACGCCCGATCCCCTGGTGTCCCCCTTCCAGAGTGGAGTGA
TAGTGATGCAAGATATCTTGATGCAGCGTCTCCGGTGCAACCAGTCTCATCAGTCCATCTCGATCTGCCTCCGATCGCTTGGAGGGTGGGCAATAGAACA
GCAGATTATCACCGTCGATCTCGTAATCCGCTGCGATGTTGCCATAGGATCGAGCCTCATCCTGCGTCAGATCAGCCACATCTCCCATCAGGTACTTCTT
CATACCTGCGATCCACGTTTCTTCATCTTGAGCTCGACGAATTCGATCGATCCGCAACCCTCGCACAAACTCCTCCTGCATAACGGTCGGGTTCGGTCGT
GATCTTGCGCCCGATCGGTTGGTCATCGGCGATAGTCGGGCGATTGACTCATCCGATCGAATAACCAGGATCTCATTAAGTCGGTTCAGTGTCACTAGAT
CCCCATGATCGACCTCATCCTCGACGACGATGCCCCCTTCACGTTGGAGTGCTGCACTGGCCAGGCTGTCCGCACTTCCGTTCCAATCTCGTTTCACATG
TAACAGCTCGTGATCGGGCCAGTTCCGTAGTTGATCCAGCACCTTCTGCTTCAATAATGTCAGCTTAGGTGCTTTGCAGTCGATCTCGCCCCGTACTTGT
CGGATCCCCAGGTTGGAATCACCGCAGACCACTAACCTGCCTCGATCTATGCCATCAAGGAGGTCGAAACCCAACAACAGACCATGATACTCCGCTTCGT
TGACAGTCAGCCCTTCAGCATAGCCCGATCGTGCCTTCACCACACTCCATTCGGGTAACTTCCACAAGATCGCGCTGTACGCGCCCCCGCCTCGCTTGAC
GCGGGCGGATCCATCGAAACTTACCACCAGCAGCTCTTCGTCCGCACGCACCGTCGGGATCGGGGCCTGAATCTTGCGCCGGGGTTCTTTCTTCGGCGCG
ATCGCGATTAACGCGTCGTCCAGATCCGATCGAGGCGTAATACTAGCGGCGATCGCCCCCAATATCTCGTCCTCTCCCTTGGTGCACTTCGTGAGCTCCA
GTGTCCAGGGCGATAGGAGTGCAGCCCAGTGACCCAATCGGCCTTGAAGACCGGGTGATCGGAACAGCCACGCCAACGTCGAGTGTCGGGTCAAGACCCG
GATCGATCGTCCAACCAGCATCTTATAGTTCAGGTCCAGAATCCGTAACAGCGCCAGCACTTCTTTCTCGACCACGTTGTAGTTCAATTCATTCGACTTC
AGCGTTCGACTGACGAAGGTAACGGGATGACAGATCTGGTCGTGTTCCTGCATCAATGCGGCCGAGATCGCCCAGTCACTCGCATACACAATCACGACTG
GAGTCCGATCGCGATCGAAGTGCCGCAGGATCGGTGTCGTCGCGATCTTCATCTTCAGTGTCGAAAACGCACGATAAGCACGGATCCAGCGTTCATCGGC
AACACCGACTTCAGGAACTGGTGGAGTCCGATCGGGGTTCACTGGGTCCGTATCCACTGAATTCGGCACCTGACGATCGAGGATCTGGCGCAGATCGGGG
CGTTTCTTCAGCTCGGCGAAGTCCACCTCGCGCAGTTCGTACAGGATCGCCGCGTAGATCGCGTAATCTTCCAAGAAACGGCTGTAATAATTGAGACTGC
CCAAGAGCGACTGCATCGATCTGAGCGATCCGGGGAACGGCAGATCCATCTGAGCAGTGAGATCCTTCGGATTGGCCTCTAGCCCGTCGTTCGACACACG
ATGTCCTAGATAGTCCACCTTACGCATCCTCCAAGAGCTCTTCTCCACACTGATCGAGAGGTCCCACTTATCACAAGCGTCCAGCAGGTGATCCACGCGA
TCACACAGCTCGTCACAAGAATGTCATCAATGTACGATCTGCGACCTAGCACTGATGGCCGTCCCTCATCTTCTGGTTCTCCTGACTCGATCAAGTCCGT
AGTGACTTCACAGTCCGACGATCGTGGGATCCTGGTGAACCCATACAACGCGTCGTCCAGAAGTCGCGGATAGATCTGAGGAGCGTTCTTCAGGCCGAAC
GGCATCCGGTTCCACTCGAACAGACCCATGTGGGTGATAAAGGCCGAGATCGCACGAGCTCGATCGGTCATTGTCACCACCCAGAATCCACTAGCCATGT
CCAAAGAGCAATACCAGAGTACCTTGTCCAGATCTTCCAGCAGATCGTTGATCAAGGACATCGGATATACCATCAGCCTGGTTAGACTGTTGACGAGCCG
ATAGTCGATACAGAGTCGGATATCTACGCCGTTCTTCTTGATGATCACGACGATCGGCGAGGCCCACGGTGATCGAGATTTCCGAATCATCTTGGCTGAC
AGTAATCCCTTGATCAGCTCGGACACCTTCTCCACAAACTGATGGGCAACTTTCCGGACACGTTGAGCGATCAGCTTCGCGTCGCCCACGTCGATGTCGC
AGGTGACGCCCCGGGCTGCTGGGGGAAGTGCATTGCCCTTGCCGATCAGCAGATTATTCCTGTGCCAGATCTTCTTTCGCAGCCGATCGATCTCCTCCGG
GGTGTTGAACCCCAGATCTCACACCTTGACATCATCAATCTTAACCTCATCCGTCGTCGAGATCACAATTTCAGGAAGTACAGCTAATTCGCCTTCGACA
TCTTCTGCTGACAGATTCCCGCACTCGTGGTAATGGACCTAATCATC