Description :
From Genome Similarity Track
Location :
Scaffold_58:34791- 39838
Transcript NameFunction/comments
Hyaar_Emoy2806977SAP30 binding protein, isoform CRA_e
Hyaar_Emoy2806978hypothetical protein
Hyaar_Emoy2806979sodiumcoupled neutral amino acid transporter putativ
Hyaar_Emoy2806980hypothetical protein

Sequence
5047 bases(100 bases per row)
CAAGCTCACGATGGCGCCTTCGTAAGCGAGCCGTGATGCGTTACTATTGGAGGCGTACAGCGACGCCGACTTCGCGGCCGACAAGGCCGACCGCAAGTCG
CTCACCGGAGGAGTGGTGCTTTTGAATGGCATGGCAGTGTCATGGTGCGCCAAAAAGCAAGGCGGCGTGTCGCTATCCACCATGGAAGCGGAGTTCGTGG
CTGCTAGCGAGGTCGCGCGCGAGTTCATTGGCCTGCGGCAGCTTCTGATGGAGATCGGCATGGCGCCGGTGGTTCCCATGCTACTGCATGTAGACAACCA
GGCTGCCATTAGCAGATAGAGGGTGAAGAGTCGACGAGCAAGGCAAAGCACATCGACGTACGCCACAAGTTTGTGAAAGACTACGTGCAGCGCGGCATCA
TCCGGGCGCAGCACGTCCGCTCCAAGCTTATGCTCGCGGACCTGACGACGAAAGCGATGGACGCTGTCAAGCTCGCGACACTCCGCGGCTTGATGAGCAT
GGCGTAAGGACTGCCGCAAATGGAGAAGCGCGGTGCACGAGCAGCTGGAGGAGCGCTGTGCGGTGACGGGGCACGAGTGACAACCATGGTGCTGTGCGAA
GACGAAAAGCGAGCGACAATAACAACGATGCTGCTCAAGGACGATGTGCTGGCGACATGAGTGGCGAAGCGAGACGTTACACACGCAAGCGACAACGATA
GTATGGCGCTGCGTGAAAGCCGGTTGCGTAGCCTATCACTCACGAGGAGGAGTGTTAGAAAGTGCATGTCTAGTCGTATAGCAGTTTCTGGCGACGCGAA
AGGACGCGCCTTTTCGGTAGCGCTAGGCGACGCATAGGAGGCAGCGAAGAGGTGTTTGAAGAGTCGAGGGCGACGCTAGAGAGTGGTTGGTGCAGAGAGA
TCGCAGCTAGCTAGCACAGCAAGAGCGACAGAAGCGAGAGATAAATACAGAATCTATTTTACCTACCACACCTCACGTCCATCCTTCTTACACTTCCAAC
ACGGCATGCTACACAACACCCAATGTACATCAAACTTATCCGCAACTTACGATTTCAGAATTATCATGTAAAATTATATTAAAAAAATAGACGTTGGAAT
GGGTGGTATTTGCAAAGTATTGTCCTTTAGTAATTTAAGCTGCATTCTTGAAATTTATCCTTTGATTTCGAACTATTTGCCTCGTAATGTTCGAAACGGA
TATTCGAACTGCTTACAATTTTTAATGCAAATATTTGATGCCGCCCAATTTTGATTCAAATAGTTGGATGTACCTCAACGTTCGGGAAATGTTCGATTTG
CCCAGCGGACTCCATGGAATATTACCTTATGCCCATGTGAAAAGGTCAGCGGACGCGAGGTTTATTACTTAAGCGAGGATTTGCTATATGAGATAATGAC
TTAAAGAAGGCCGTATGTAGCTCAAATTCTGCTTCGCTATTACTATTCTTGATCATTAAAATGAGCAATCTTAGACGTTTTGCTGCACACGTACTGTGGT
GCCCGCCTACTCATGTTCGACACGATCAATCTCTATGTAACGTATGCCCCTTCGATACTTTTTCTTGCTTTGAGTATTACCTGATGGGACTCCAAACTTG
TTGTGTGAGCAAGCAATGAAAAGAAATCATGCTCAGGCAAAAGCCCAAATGAAATCGAGATTGAGGCTTAGTAGCGCAGTGTTTATTCAGGATACAATCC
CTCATCCATGGATCGTACGATTTCCTGACAAGCGTTAATTTTTAATCGACAACCTGATTCAAGCTCAGATAAACTCTATTCATGCATTCTAGGTATCACG
GCTGTCCTAAGCTTTTTAACTATAGGTAGCTAATTACTATTAACGTGCGTTAGCCGATACAAATTGAACCTGACGTTGATCAGCATCATCCCGTTGTTGC
TGTAGCTGACGCTGCGCTCGGGCATTGGTGCGTTTCTTCTGCTCGACTGCTAATACGTCCACATACTCGTGCAGCGGAAGACCGTGAGGATCGAACTTAT
CCTTTGGAAAGTTGGACCGCAGCTCGTCGATGCCAAAATACTCGACCACCTTCTCAAGGATGTACGGGTTCCGCACTTCCTTCTTGTCCTGCAGCGTCGT
CTGGAAGTCCTGGCCGCGTTCGCGTTGCATCCGTAAGAACCGCTCTATGCGCTGCTGCGTCACGTTATCAGCAGCCACAGAATCCGCTGCCGGCGGTATA
CCCGCTTGCAGTAGCATCGCCTCTAGATCATGTTCAGTAAGAGGGGTATCTGCTTCACGATCTATATCCGTAAATCCGACCTCTTGCTCAGCAGTATCGT
TGCTGGGCCGGACTAAACAAACTTCATCCGTTTTCTCAGAGACCGTGAATACTGAGTCTACAGATGCTTGTGCAGCAGGGGAAGAAGATGGAGTAGAAGA
AGGCTTGGAATGGGTCACCCCAAGCGAATTTATGCCCTCCTCATCCGATGAAGACGACCCATACTCGATCCCCAGCGAGTTCATTGGAGCTGCGCTGCTT
CTTCTGGTCAGCTTGGTCGCAGCAGTTTTGATCACTTTTGACCTCTTCCCAAACTTGATATTTATGAAGCCATGAGCTCTAAATACCGATCGCTGCTGGT
GTGTAAGAAAGACGTAGCTTGTTAACCTGTTCGAGGTATGCTCGTCGTATATAAAGTGTGTGGGGCGCGTGAGCGCCCATATTGATGAAAAGGTCGATGA
GTATGTACGGCACAAGTCCAACTTTGACACAGCAACCGTTGCTCGGTCTTTGTGTACTAGCGGGTGGACAGATTGACTTGAAAACTTACGAGATCATTAG
CCTACAAAGATTGACCTCCTATGGCAGTCGTCGGTTGCTTAAACATCAATATTCCGATCTTACTCTCGCCCACAGCGAAGTAAGTAACACTATTAACACC
CTTTTGCTTTCCAGCTATGGGGCGAGAATGGGGGGGTATTAGCAGCCGGTTCCATCTGGCATCTGCAGCTTGTTGTCGGCTTTTGACGTGTCCCCAATGC
GGATTCTCGCGGAGCACACACCACGCACGTATGGCTGGTAACCTGCAAAAGGTGCGAAGTGGCTGCATAGTCGACTCTGTGTGTTGCGTTTCTTCACTGG
ATGCAAGGATTTTACGCCTACTTTACCGTTCTTCCGTGCCTATATCAGACAAGAGTTTGCACAGGGTCGTGCGTTTGCTATATAAGCCTTCTGAAGATAC
GCTATCAGAGGCTTGGCCATTAAAGGGACGGTATCTACATGTTGCATTGGGCTGGTTCTAGCTGGTCCTGTGGTCACAAAGATGCTAGTCAAGCGCCTGG
TACATATATCGTCTGGTCGAAACGGTGATCACGTTGCAGTGACCCGTGGAAAGGGCATAAAGGTAAAATATTTTGTGTTGGTGTGGGAACGGCAAGTATG
GAACAATGGACTGCAAGGTAGAATGACCATCACGAAGTAAAATATGTAGCACCTGTTGTCCACGTCGGCGCGGGTAACACACGTAAAAGTACCACACCAG
CCGAGACAGACTACAAGCTCACAGTAGTTGATAAGTTGCCGCGGCGGTCAACTTTTACTACAGGCATGGACCGGAGTGACAAGGGCGTGCAATTGTGCTT
TGTACTCTTCAATTGCAATGACGCTTAGACAGCGCACGATATACACGCACGTGTCACGCGAAGCTGTGTACACAGGATCATAAGCTTCTGACCGAGTCTA
TATGTAAATTCAGCAGCGGTGGCGGAAATCGTCTCGTAGAAGACACTCGAAGTTGAAGATGCCCAGGACGAAAATGGAAGGTTTCTACGGCCTGATATCG
ACATGCGCAAGTTACCTTTATTTTCTCAGGTATATGACGAGTTCTCGTTGTTTGACCTCACGGAAGTTCAATGCTCGTTTTGCCGCACTTACGGCAACGT
CCCCGCCATCGTTGCCACGCCTTTACATATCGTCCCACTATTTTGTAACGTATTTGTGTATCGTATGGGGGTCAGCACATTCCTCGTATGCGTCGATGTA
GGACCAAAAGGTTTCCGAGGTCAGTGCAGTAAATCTTACCGAACTAGAGTCATAAACTGTAAGCGTCCCCCTTGCATAGCGTCAACACTGTCGCACGGAA
CTGTTTACGCAGGACTCAAAGATCCGCGAGCAACGACTTCCAGATCTTTATATCAGGCGTAATCCAAGTCACGCACATAAACAAATCCTGAAAGTCACTC
GTGTCTGTTCAAAATCTTCATCTTACAGTATACTAAGATTCAGCCAATGTGAACATTCGAGCCAGCTCGACATCGTCGTTCAGTCAGTCTAGAGTTTTCG
CGGTAGCGCACAGTCGCAGAGGATAGATAGATAGATACCACCCCTCCAGCAATATGATCGACACGGGCGTGTACCGCTACGAGCGCAACCGCGAAAGCCA
CGAGTTCTTCAGTCCAGGCCCGTTATCCTCTGCACGTACCGCTACCGCCCCGTCTGCTATCTTCAACCTCGTGAGTACCATCATCGGTGGCGGTATCTTG
TCCCTCCCTTTTGCGTTTGACAAGTGCGGGCTCATTGTCGCGTTGATCTTTATGGCCATCGCTGCCTCCGCCTCCACTTTCAGTCTCTATGTCATTGTGA
GTTGCAGTCGACGTGGACGTGCGACCTCATACGAAGAAGTGGTACGCAAAGCCCTGGGAGCTCGAGCTGGCCACGTAACAGTCGTGCTGCTCGTGCTGCT
TACGTTCCTCACACTTGTGGCATACGTCATCCTCACCAGAGATCTAGTGGGGTCACTAGGGGAAAAGTTCCTCTTCAATCGCCCCATCTCTGGGGCCGAG
CAGAATGGTCTAACCATCCTCTGTGTGCTCCTCGTGTCGCCGGCGCTGCTCGCGCGCTCGATGAATGCATTACGCTTCACTTCTGTCTTCAGTCTCATGT
CGGTACTTGTGCTGGCAACGACAATCACGATCCGGGCAATCGGTACTGTCGTTGCCGATCGTGACGATGGGACGGTCGAAGCCGCTGTCCGGGTCCCAAT
CAAGCTGGTTCCTGACAGCTGGGTCGATGCTGCCTACGCTTTCCCCA