Description :
From Genome Similarity Track
Location :
contig_9:3479- 4543
Transcript NameFunction/comments
g2206.t1hypothetical protein

Sequence
1064 bases(100 bases per row)
TCTCTGGGCGCCTTCGCTGGACCTTGTAGGTCCCCAATCAGTTTCGGGCGCATGATCTTCATCACCCGGTCTTCGGCCAAGAACTTGTATAAGTCCTTCC
GGTAAAATGCAGACTCCAATTGTTCCTCCGTCCACATCTTGCGATCTTCCGGGTCTTCGGCATCCGACTCCGGCGCTTTCATCTTGGTGCGTCCGGTCGG
CGACCGCTTCTTCGACGCTGATCGCGAAATCGGAGGAGTAGTTTTGGGTGAAGATCCTTTGGCTTTCGCCATCGGATCTTCATCCGGCGGATCACGATTC
GCATCGCGATCCGCGGGGGTCCCCGAAGGGACCTGGGGAGGGGGGTAAGGCTTCTCTTCTAGGTCCATTGCTGAACCTGCCTCCTTCTTCGTATCATCAG
AGTCCCTCCCAGTACTCTGCTGACTCGATGATCCTTGCGCAATCAGCATCATCGACGGCGATCCATCTTCCGTCGACGACTCATTCCCTGGTTTGATCTT
GATCTTGACATCCTCTTGGTTAGACTCACGGTGAAATCCCTGTGAGTCACCAGAAGATCCGGGCACGCGCACCATTGTGGCGGAGCGGGATCACAAATTG
CTGATGTGACCGGCACTCGCCAACGGTTGCCCGGACTGCCGACTGTCGGAGGGGGTACTCCGTTGATCCGGTGGATCTTGACCTTGTAGCTCACCTTGTG
TACCCGACGGCTTGGGCGGGTTGCACTCTTCCGGTACTCACGCGAGGAGTATCAGTGGTGATCGAGATCGGGGTTTGAGCTTGATGGGCTCTTCAGGGGA
TGGGGGGTTTGACAACTACGCGGATATGCTTCACGCAGTCGGTCGGTATCAGGTGTCGATCGTGTGTGGGATCGATCACAGGGGGTTGTTTTCCTTTGCG
GGGTCCTTTACGTTGCTTGCCGCCTCCTATGGCGGGGTCTTGATGAGTTGAGACAGAAGGGAGAGCGCGCCTAGCCAAGCGATCTAGGGGCTTCCACGTT
TACACTTGATTTCACTATGTGGGTTGTCGGGTCGTCGGGTAGGCCAATATACGGAATTCCGCTG