Description :
From Genome Similarity Track
Location :
Scaffold_267:34786- 36832
Transcript NameFunction/comments
Phypl_g6195hypothetical protein
Phypl_g6196hypothetical protein PHYSODRAFT_491966

Sequence
2046 bases(100 bases per row)
ATCCCATTGCAAGAAGACGCCCCAGCGCCTTCCCGTCTGCAAACTGGATCAGTGGCTGCTCGCTCTACCGACGTCAACGACGGCGGAATGGTCTACCATG
AAGGCTTGATGAGTTCGCCAGCGAAGTTGTCCAGAATcccaactccagcagctacTCATGACGATGGCGCCAGTGAAGCAGAGGGCGACTACATGGATGA
CTCCTTTGACCTCGACGAGTCtctggaggaggaagaagacaaCGGTGAGATACACGTTTGAGTACTCCCCACGCTGCAGACAGTAAGGATGAAATATACA
GATGCATTCAGGCTATTCGACGTGGCCACTGCGTCAGCGACGATAGGCACGGGCGCCTACAAAAGGCGGCGCACCAGGCTCTTGACTCGCGAGTAGCAGC
TTCCGGTATCTGTCTAGGGACTCGGCCCCTAGCAGGCCGCCGAACTTGACTTGGCCGACGCCTGCGCCCATGGCGAGTGCGGCGAGAACctcagcgtctg
cacctgGTTGTCCGGCTGACGCCCCCAAGATGACCGTGAGTCCGAGGTGTTGGGCGTTCGTGATGgcttgcagcagtcgcgACACCGTCGGGAACTCGTG
CGGAACGAGAAGCACCGTGTTACACGCACGCTCCTCGTTCAGAGCTGCCAGGCCGTGCCGCCCCACGACGGCACGCCCCACAATTTGAACGCGGCAATTC
GGATCACCTCCAAGCCCGGCGTCTTCCTTCACGCCACCTTCAGCATCGGCAGGGTCTCCGGACGTTAAACTGTTGTCCACGTCGTTCTCCGTGCTGTGTA
GCGCCGAGAAACTCTTGACGTCGCCGGCATCGAATGGGTCCACGACCGTCGtgatctccagctccttgacgctgctgcgcacgatgtccagcagctcgtc
gctgttctTAAGCGCGCCACTCGAGCCAGGCACCCACCGGTCCGTGTTGTACGTGAACGCCCGAGGCGGctcgttgtcgtcttcgttctgcccagcagcg
tcgctgtccgtccGCGCCGGCGGCACCGCGAACTCCGACGCAGCGAAGTCCACACCAAAGTCGACACGCAGAGGcgatgcgctcgcgctggagatAACAC
GCGCGTCCGGGTCTTCGAGCCGCACTCGGACGTCGTCCAACGCAGCGCGAAGCACCTGGAAGACCTCGGCCAGAGTCTGGAGCTGCGGTGCAAAGCCCCC
AAAGGCTCCCCGGTTGGTGAAGCCAACGCCCCGagcctcgagctgcgcgtggagcgCCGTATTGAACTCCACCgcgatctgcagcgcgtcggcgaagctc
gccgcgctcgtaggcgtcagcagcacctcctgcgcGAACAGTTTGTTGGACGCGTACTTGCCGCCGTTCACGACGCTGAAGAGCGGCATGGGGACGCACT
GGTGCTCCGGCGGGGCTTcttgcagcttggccacgtactcgcgaagcggcagctcggcgtaCTTGGCCCCAGCCTGACACAGCGCTAGCGACGTCGCAAG
ACACACGTTGCGCCCCACGGCCGGCTCGAGATCCTGCAAGATCGTGTCCAGTGCGCTTTGATCTGTCGGCTCCGagttcacgagcttctccgtcAGTAGG
TGCTGACTGGAGGCTGCGATCTTGACGAACCCTCGACCTTCGTAGCGTAGTTTACTGGGAGCTACGCTAGCGGTGGCGTCTCCAaggtcgctgctgcctt
ccGCGTCGAAAGCTTGAGCGTTCGCACTGTATTCGCGGTCCGTGACGCCCCCCGCCtcggcggagcagcagccttcgaAGACCCCTTTGCCCGTGTGCAG
CCTCACCAGCACGGTGGGCTCCCCCGACGCATCCAGCACGTCACACACTTGCACGAACAAGACGCCGCGCTTGGCCGTCGCCCGTGCgtacagcagcgac
gagagcatGAGGAACGGGTCTTCCGGTCGACTGGCCACCACCTGGTTGATCACGTCGTTCAGCGACaactcgagcgcgtgctcggcCACGTACGCTTCGA
CCACGTCGCGTTCCCGCACTTgttcttcctcctcgtcttcgtccgg