Description :
From Genome Similarity Track
Location :
Scaffold_48:347813- 352229
Sequence
4416 bases(100 bases per row)
GCCCCTGTCCTGTCCCTGCCGGACGAGACGAGGCCGTTTAGTGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGG
CTGGACACGAACGAGTCATCTTGTTCCAGTCCAGGCAGCTTAAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAGTATGC
CCTTGTGAAGCTTCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCC
CAAAGGATGACGAGGTGGCTGTCCTTCTTCGCGGAGTACAACTTCCGCGTCGAATACAAGCCGGGTAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGC
GTCCTGACTATGAGTTGACCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGCATCGGGACGATGAGGCTGTCGCGCCTATCGT
CAAGTTCCTTATGGCAGGTACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGATAGCGCTCCCGGCTTCACCGATACGAGCTGACGAATGGCCTCCTCTAT
TACCGGGTGGAGCCCAATGAACCTCCACGGGTGCTCGTACCCAACGACGAGGATCTGAAGTTCGATATCCTCGCGGAGGCGCACGACACGTCCTCTGGCG
GCCACTTGGGCCGCGAGAAGACCTTCCTGTCGTTCTCTCAGTCCTTCTGGTGGGCCCACATGTACAAGTGGGTCGCCTAATACGTGAAGACATGTGAAAC
ATGTCAGCAGGTCAAACCCCAAGGGCACACTTCGGCTCCACTACAGAGCCTGCACGTACCGGCTGACTGTTGGAAGGCGATGAGTCTTGACTTCATCCTT
GGGTTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGCCAGAGCAAGATGTACCATCTTGCTCCGGTTCTCGTCACTGTTACGG
GCGGCAAACCGGAAGGTTGCTCGTCGATAGGGTGTTCGCTATCACAGTCTCCCGGAGACGATTGACTCGGACCGAGACCCTCGGTTCACGGCTGCGTTTT
GGAAAACGCTGTTTCCTTTGCTGGGAACCCGTCTGCAGATGTCCACTGCGGACCATCCGCAGATAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGA
GGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGCTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCATCCACG
GGGTTCACGCCGTTCTACTTAAACGGCTTTCGTCGCCCCAGAGAGCCTCTCACGCTTCGAGGAGACACTGACACCTCTATTCGAAGTGGGGGAGAGGCTC
GGAAAGCCCTTTCCTCCCAGGTATCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGTGGAATCCTTTATGGATACCAAGCTGAGCGTTGTCAGCAGGGT
CCGCGATGCCATGGCAGCGGCCCAGGATAAACAAAAGGAGTACTCCGACAAACATGGAAGAGGAAACTTAAGTGTATTTAAAGTGGAGGACTTATTGATA
CTAGCCACGAGGAACCTACCTCTTGATACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACTGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATG
GTGCGTCGTACACCATCGACCTGTATAAGTCAATGACGACGCACCCGACGTTCTATGCTGGATGTCTTAAGCGGTAGTTTGACCCGCAGGGGGTTGCTGA
CTCGCAGACCCCCCTTGACCTAGCTCCTCGAAGCAAGGGCCGGTCACAGACGTCGACGGGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGAACGGCAA
CGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCGTACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTA
CGTCTGTGAGTGCGTCGAAGGCGGCTCCGGGCGTGGCAACAGAGCCTCGATCCGTCGGATCATGCGGAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGG
CGATCCGCCCGCAGATGCAGGCTCGCGACTTCACTCTCCAACAGGTCTAGGCGGCCCGCAAGACGAGCGATCTCGCCCTGATTCCCGGCCTGGGCGGCAG
CATCACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGAACACGTTGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGGAGAAGC
ACTAGGACGAGAGTGGCGTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGATAAGTCCACTTCCACGT
GGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTTGTGAAATGGAGGGGTTATGCCCACTCCGAGAACTCGTCAATTGGCTCCTGA
TTGACTGCCCGAAGGCTGTCGCAATATGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCTGGGGCTTCTTGCCCGAACGGGGTACGGACGTTGAATAC
ACTCCGTACCCGCGCGCATCGTGAGCGCTGGAAGCCGCACGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGTTGACCAAGTGGGCAAACCGAACACGAA
GATCCCGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGCTCCCGTAACTCCGTGGGTGAGTACTTGAGAGACTCCACCCATGCTCAGAACAT
GTCCTCACAAGAACTCCAGGTGGGACCGTTCTCGGGCATAACCCAGGGGTATCCCCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAA
GTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAGCGAAACAACCGTTCCTTCTGAACAAGGGCA
CGTTCGTAAGTGCCCCTAGAAGAGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCCAGGAAAAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCC
AATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTACCACCACCGACCCCCCCCCCACGCACACGCTGGGCAGCTTGGAATTCCTCCTACTGCT
GGTCGAGGTCATTCGAGACCTCCCGGGGCTCAGCAATAGCACCCTCCTCCTCTTCTTCCTCTTTCTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCTG
ATAGGAGTGTTGAGTCTTCTTCTCCTCGCGGAGTGGAGACTTAGAAGCTGTACGTTTCTTAGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCACGC
GCAAGACCCTCGGCAAGCGAGAGACGTTTACGAGGTTTCTCTTCCTCATCGCCACCGGCTTTAAGAGTACCCTTAGCCTTGACGGCCGGACTCTCAGAGC
GCACAGACGTCCTGGGCCTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATCCTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGA
GCCCGCAGGAGCATCGTGCGTGCTCTCGGACTCGGCTTCGTCCTCACTGCCAGAGTTGAACTCACATTCCACGAACCGAGGGTTCGGACGCTTGTCTGAG
GCCGAGGGCGACGGACTGCGGTGCTTGCTTGCTCGCTTGCCCACAGCCGCGTCACCCGAGGAAACGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGA
GTGCTGAGCCTTTGCCGTTAGGCTTAGTGCTCTTGACTTGCGACTTACCGGCAGCAGCCTTGGAGCGTGTCTTCGCACCGCTCTTTGCAGTGTCACGAGG
CATAGTAAACGGTCGAAGTGGAGACCTAGAAGAAGAGCGCACAGACAGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAA
GTCGACGGTTTTCGACTTTAAGAATGAAAGTTTGTGACGAACACTTCTTCATGAGAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCT
AAGTGTACCCTGGTTACATGAAGTGTGACAATTCACACTTCAGGAGTATGACACGTCATACTTCGGGATATTTGGTACAAAGTACCAAGGTCGTTCAAAG
CCAACCATTGGTCAACGACATTGCATTTCTATAGGTGACTTATAGTTTGTATTAAACCCAAACTTTATCTACCTATAAAGATACTCATTTTACATCCTAC
TCACTTCGCGCTCTTTTAACTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTG
TGTGACCCCGTCACAT