Description :
From Genome Similarity Track
Location :
Scaffold_14:34777- 36052
Transcript NameFunction/comments
Aphas_H257_06094conserved unknown protein
Aphas_H257_06095Hypothetical protein
Aphas_H257_06096WD40 repeat-like protein

Sequence
1275 bases(100 bases per row)
CACACAAATCGATTCGAATGGACGGGGGAGGCGACCAGATGCATCGGGTCTATCGAGGCCTTGGTGCTGCCAAATGGATTCTCGGCAATGTCGATGCGCC
GACCGGCGGTCTCGAGGACGCGGACATCGCGCTGCAGATCTTCGTCGCTAAAGGATGTGAGGAGGATCGGACGGTGAGACTCGAGGACCCGCGCGAGGGT
GGGCCGCCACTGGGAGCGCAGCGCGGGATGGCCGAGGCCAGGGTTGAACAGGACAAACGCATGCGGAGATGGCAGGTCGAGGTCGTGATAGAGTCCGTTG
TGAAACGACAGGTTCAATGAGGAGGATGGCGGGGAAGGAGGAGTCGAGCGCATCACGGGCACGTGGTTGCCGATGAGGGAAATGTCAAGTCGCCACGGAT
GCAATGGGGTCCAGAGGTGGCGCGGCATGGTGGCTTCAGCTCGCGCGCCAAGAATGTACACGCGATGTGCTGCGTCAATGGAAGAAGAGATGGAAGGAAG
CAAAGCTAAGGACGATTGAGTGTGAGTGTGGGAATGGAGTCGTAGTGGATGCATAGACATACCTGGCAAATAGTGGCGAAGGGTCATAGGATACGAGTAC
GCGGCGGAAATCAACCGAGTGACGGCAGGGTCATGGGCCAGATGCGAAGAAACGCCAGCATCGGCAAGCATGTCGGCCCATGATGTCGTGGACGAGGGCA
GCGCTTGCGTTTCCACTGAAATCATCATACATGTGAGGGAAAAGCGACATGGAGAAGGATGGATGTACACTGATGAAACAAAGCACGCACGTCCGGAGAC
CTAGCGCACTCCAAGTCGTCCTTCAGTGTGAGAAGACGCGCGTGAGTGTCGGCGTGGTCGGTGGCCAAAGTGGACTCGCATGTGGCCGAGCAGGTAAGGA
CATGGCCAGCCTTCATTTGGCCGCATACTGGGCACGGGAAGTTCCATGCATTCAATGGTGCCGCATCTTTGCTCATACAGCGTCGTTCCAAGATGGAGAG
GGCACTCCATCGCCGCCGCGACGGCACAGCCTTCCGCCACATCGTTGTCAAAAATTGCATGTTCAAAAACTGCAGATATTTTAATCATTTTATTCCATTT
AAAATTTTGCATCGACTCCAACACTTCAGCGATGGAGATTGCGAGCGACGATGTCATCCGCCTCATGCAGCAGTTCCTTCGTGAACACAAGCTTTTCGAC
ACCCTGCACTCGTTGCAACAAGAGTCCCAAGTAACGCTGCAGGCGGTGGACTCGGTGGACGCGTTGGCCCATGAC