Description :
From Genome Similarity Track
Location :
Scaffold_16:347737- 348884
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G006754Similar to ABCA3: ATP-binding cassette sub-family A member 3 (Homo sapiens)

Sequence
1147 bases(100 bases per row)
GCAAGAACGCAATGGAAGCGCCTTGTCTGTCCAGCGGTTACGCAAGGTGTTTCCAGTCCCTGGAGGCGAGAAGATTGCGGTGAAGGGACTCAACTTGGTG
ATGTACAAGGACCAGATCACGTGTTTGCTCGGCCACAATGGTGCTGGCAAGACGACGCTCATTTCCATGCTCACGGGGATGACAGCACCGTCTGGAGGAG
ATGCTACCTTCCGTGGGATGTCGTTGAATGACGATATGGATGACATTCGTGAGTCTCTGGGTATCTGTTTCCAGCACGATGTGCTATTTGGCCAACTGAC
TGTCGAGGAGCATTTGCTGATTTTCGGTCAGATCAAGGGATATGTGGACGAAGAGTTGAAAGCAGTCGTGGAGAACCAGATTCGTGAGGTCGGATTGACA
GAGAAGCGCCATGTGAAGTCCAGTGAGCTGTCGGGGGGTATGAAGCGCAAGCTGTCTGTGGCGATTTCGCTGCTCGGTGACAGTTCACTGGTGTTCCTGG
ATGAGCCAACGTCTGGTATGGACCCGTACAGTCGTCGTAGTACGTGGGAGATCTTGCTGAACAACCGTAACGATCGCGTGATGGTGTTGACGACCCACTT
TATGGACGAAGCTGACATCTTGGGCGATCGCATTGCTATCATGGCTGAGGGAGAAGTACGTTGCTGCGGGTCGTCGTTGTTCTTGAAGAATCGATATGGT
GCTGGGTACAACTTGACGCTGGTGAAGGATGAAGCAGGCTGCAACGATAACAACTTGATCGCATTCATTCAGTCGTACATTCCAAATGCGCAAGTGTTGA
GCAACGTGGGCAGTGAGATCGCGTTCCAACTTCCGTTGGCGAGTTCATCTGGATTCGCAGCCATGTTTGCTAAGATGGATAACCAGCTGTCGACGTTGGG
ACTTTTGTCGTATGGCGTGTCGGTGACGACATTGGAAGAAGTGTTCATCAAGGTGGCTGAAGCGAACGATGAAGATCACCAGCACACGCTCGGGAAGCAA
GCTCGGACCGGCACTCCTGCATCGAGTCCGGTACATAGTGCTGATGGTGTGGTCACCCAGCCAACTGGCATGTTCATGGCCCATCTGCATGCGTTGTTGC
TCAAGCGTTTCCGTATTGCTAAGCGTGACAAGAAGATGCTGTTCTAC