Description :
From Genome Similarity Track
Location :
Scaffold_2097:3477- 4896
Transcript NameFunction/comments
Phypl_g14665hypothetical protein

Sequence
1419 bases(100 bases per row)
CTATAAATATATTCCAGGCTTAAAGCTACCTTATCtttggtaccagtccccttcaggccagggaccAAGTGAACtgtcgttcactgggagtttgtaaAAA
CTCCGAAGTACACgcttcctctgtgcaacgtgcttgtgtgacagcccgtcacactTGGGAGCACTTGTTGTCAATCCGACACCTACGCGGGTGGATTGGA
CTACCTGAATCCTCTGTGGTCTCTAAGAAAGAGAGTCACCATGGATTGAGGAGAGTTTCCTCATTTGACTAACGCTCAGTTTGAATCGGTCCAGAAGATG
GCGGCCATATTTGGGATGGATGCCTTCCGAAGCttggcagcggcaccaccgcccgagcaggtcgagcgcgTGAATGCGTTTGACACCTACGAGGGTTGGC
TCATCGCTCACGTGCAGAGTTTACAGCCTCCTCAGGCTGCGCCGAGGCCGGCCCAGCCTTGAGGCTGAAGGTCCAAGtctacgacgagaaggaaggTGAG
AACCTTCACTTCTGGGTCCGAGAGGCTGTGCTCGCGATGGACGCGGCCCTACTCTCGGACGAGCGACTTCGTGTTGCTTTTGCGCTCTCGCATCTCGGCG
GTCGAGCCAAGAGCTGGGCTTACACGCGTGAAGCGACGTCGCCTGGATATTTCACAACCTGGGCCCAGCTGTGTGAACAGCTGCGAGCCGCCTTCCTCCC
GGCGAACTGGGAGTATCACCAGTGCTCACGCTTCCTTGGCTGCAAGCAATGGAAacgtgagctgcacgagttcATCCAAGAGATGCGCGAGCTAACGGAA
TCTCTGGTGGGGAACCCCCTACCTGAACACATCAAGGTCATGGACGGGCTCTGTGTGAGCCCTGCTCGCACGCAGCTATTGCGCGTGCAAGTCAGCACCC
TGAAAGAGGCGATCCAGATCGCCCGTCAGGAAAAGTACAGCTACAAGCAAACTCGTACTCCCACCACGGCGTGGAATGGCTACGCAGGCCCGAGCAATAG
CTCCGCCAGGGGTGCTCCCAATGGTCCAGTGCCGATGGACCTCAGATTGGCCGATAATAGCAGTATTCGCTGCTatggctgcagcaagctaGGGCACATT
AAATGTGCCTGTCCTGCGGGACAAGGGAGGACTAACTCTTCCAAGCCCTTTGCTCTGAAGGGTCGCTGGCAGAAGCCGCGACCAGGGGACCAGGGAAACG
CAGGACACCAGTAGGGACGGGGGGCCCTACTGGGGAAGACCTAAGTCTTCATGAACGGTGCGCGGGTGGCGCGCACCATGAAGGCTTAGCCTCTGATAGT
CTATGCACTCTCGAACAGAAGAACGGCAACGGTGGGCTGCTAGTAGTACACGCACGTGTACGGGGATACGATCATCCCTTCCGAGTTTTGATCGACTCTG
GGGCGTCGAAGAACTTCGC