Description :
From Genome Similarity Track
Location :
Scaffold_78:34766- 39495
Sequence
4729 bases(100 bases per row)
CCGCACCGAATGGGCTGCATGGATGTTCTTCCACTGTTCGAGTATCGATAAGCTGACCACCAAATACGTTCCATCGGCTTGGCCTTGGCGAATGCTCCGT
AGGAGTGCTTTCTTGAACAGTCGAGCCGAGTTATGGTTCTTGGGCGGCGTTCGGGCTTGTGGCAGCTCAACCTTCCAGGTGGGGACGATGCCACTGCGTG
CGATCGCGACGAGCTCGGTGGTGTATTGATAGCCTTGTAGAACAAACTGCAATCGTTCGGGGTCGAGGCCCTTGTTTGGGCGAGGATCATCGCCCATCTC
TCCTCGCCGCTGACGCACAGTGTCGGCCAGAGATAAATGGAGCCGCTTGCAGTGGTTGGTCACCGCCTGCTGTTCGCTGAGCCCGTTCTCCGTGCAGAGT
TGCCTTGCACCAGTAGGTTCTGTCCCAATAGAGCGATGCCACGAAATTGCGTGTAGTAGCTGGTAACGTCGAAGGCGTGACGACAGGCAGGCTCGTACGC
GGGCAGCCAAAACAAGCGACATTCCGACTGGTGCGATGTTACGATAGACTTGTACGACACCGGCGTCTACGGCGTTTGACTCGATCGTTGACTCTGGTGG
CGCGTTGGGGGTGCTCTCTGGGCTCGCTGACTGCCCAAGCAGCTGGAGCCAGGGGCTGCTACGGCGCCTTCAAAGATGCGCGAACCGCTCGCTGAGGCCG
CCCATCCGCTGGAGAATATGACCTTTTACTCGAACGTCCAAAGTGTCTGGGGCCGCGTGAGCGCGAGCGCCGTAGACGCAGCGATTCGACGAGCCTGAGG
GACAACCCATTGCTGACAGGTAGCGAAGACAGACAGGAAGTCCATTGTGGGTCGGAATTAGGTCGAAGATGGCCGGCGGAATGCGAGATTGTCGTTGGTT
GCCTCGATCACGCTGTGTAGTCGTCATTGGAGGCCGCTCACGCGAGCTGTGACGCTGCGAATCCTGAGTAGAGCGACGAGATAGTGCATGCATGAGGTTC
TGCAGTTCGCCATCGTTGAGAGAGCCGGGTGATGGTTTGCACGCTTGACGCGTGGACATCTCCGTTGCTTGAGTGAACGAGAGATCGGAACTGCTCTAAT
ACGGAGTTCACCCAAAACACGAGATGAGAGAGGTCTGGTGTCGTCCAGGTGCGCCAACCGTCGAGCTGTTGGGCAAAATCGAGCAGTGCTTCGAGAACAT
CGCGCACTGGCTGCGCAAAGAACTCCTGCCCATAACGGCAAAGCATCCTAGCCGCGTCCACCAGGTCACCCATTGACGATGGCACGGGTGGTCTGGGAGC
TGTTACAGCGGCCGAAAAGTTTTGCATGTTTGCGCCTCCTGCGTTGAGCCATGTCATTCGTTGCTGAACTCCAAAGAGTGCGAAATGAAGAATGGACAGG
CCGAACATGCCGAAGTGAAAGTCGTACAACCTGATGATCACTCCCGGGTGGGGCTGGAACCGCACAGCAACCGCATACACAACCGTCTCAACGAAGATAG
AGGGAGCCTTACCTCTGTGTTCTGGAGCAGTGATACGTTCGTGCACAGTGACCTGCACCGCCGTCGGGGAGAACGCGTACTTGGACCGTTTGGCTGGCTC
GGCAACGGAGACCGGGGGCCCTGAGCGTGCTGATATTGCGGTCGAAATCACTTGGACAAAGCGGGCGAGGAGCTCGGGCTGGTTTAGGAGCTGTTCCATG
ATGCGCGCATCTAGTGACGCTGAGGGACGGCTGGATAGATTCGGCTCGCAGCCGGCTGCCGCAGCGAGCGGAATAGAGACCTCCGAGACTGGTGCAAATG
TGGCCGAATTGACTGGGGCAGATGCAGCAGCCAAAGCAGCGTGGCTGTGGCGCGCGCTGGCCTGGCCTAGTTGGTCTGGACTGGAAGGTTCCTCATCAGC
AAACAACGAAATAATGCTATTGGCTTGTTCCATAGATGTCGTGCTGCGCGGGGTCGCGGTCACGTGAGGATGTGGGGGCAGGTGCTTGGTCACGGGTTGA
AGGAGCCCGACAAAACGACGGGCCAACAGTCAGCCGTAGAGCGGTTGGGGCAGGCTGGTTGCCGTCTACGACGAACGCGTAGTCGACCACGTGCTGAAGT
TGAAACGTGCATGGGTCGCCAGTACGCGGGTCGATCCAATGTCGCGTCGACTGCCCAGCAGGCATATCAGACGGTTGAACCAAGCCATCCAAAATGGTCG
GGATGGCATTGGATGCCGGCGCGCCGGCGCTTCCGTCCAATATCCGGGCGAGTATCGTAGTTTGCATGTCCGTTAAGCCATCGCGCGTCATGGAGGCGTG
TAATGGAACACGAAGGAGCAGTAGCGCCACCACGGGTGCGACGGGGGTAAGCCGTGCTGGTTCAACGAGAACCACCCGGTCTTCCAGTTGAAGCCGAGCA
AGACGGCCGTCCATGCCGACAACTTGGCCATGCCAGAAGCGAGCTGCTGACTCGGTCCATGCAGCCTGGCGGAGCAGCTGACGCTGTCGAGTTCGGGTTG
CTTCGACTTTCGAGACCGTGAGCGTGCGAGCCACCTCGGTATCGATGCTGCAGATGATTGGGTCATCGAGACCGAGGGATCGAATGGTCGCTGTCTCCGA
CGTGAGCGCAGTCACCGTCGCGTAGAACGGGTACTCCGCGATGCCGTCAACATGCTCGGGCAGCAGGAAGAGCTAGCCTTGGAGTTGGAGCGTAGCGCGG
CGGACCATGGGTGCTGATGGCGAATGAACTAACTGTAGAAGCTACGAAACTTGTTGTGCCGGAGGTAAAAGGCAGAATGAGCTGATTGAGCCCGTGTCGT
CCGGCTTCGGGAGCGCTGCGTCTTGCAGCCAACCGACGGAATGGTTGGCTCTCATATCCGACTCAACGAGAGTGCTACGCCGAACCCTGAACCCGACAGC
GTGAAAAGTTACTTTCACCAGGCGGTGCCCAGCAAAAGTACACAGTTCAAGCGGTCTCCAGAAGATGTCGAGCTCTTCTCGAGCAGCAAGACTGACAGCT
GTGTACTGGGCGCCAGCGATGGAGCTGCACGCATTTTACCAACCTGTCGTGCAAGTTTAAGTGAGTTTGACAAGTGCACATGCACCTCGGTACGCCAGAT
AGTTTCCAATTCGGACGAGACAGGCTTGAATGGAAAGGAAGACACACCTTTTGTCCCAACTTGTGTCTTCCAAATAATGCAATACTTTTCTTGGAGTATT
TTTCGTCGCAACGCAAAAGCCGCAGTGTCGGCTAGCATAGATCCCCGCGAACTCGACACTCGAGCTGTAGCCACCTCCATCCCGTGAATACAGCGTTCGC
TCGTCTTAAAACCAGTTCGTCAGCTTCTGAGTGAGTGGCGTTTTAGTCCGCCCTATAAAGCATTTTTTGTGGAATGCTTTTCACATATTTAACTGTACAT
TCTTTTTTCGGACTATTTTTCAGTTGAGGCAAGACATAAAAGCGGGGAACTCCCTTGCTGCTCCTTCGCGGCTGATCGACACCTCCAGCCTTGTCGTAAT
GTTTGGCAGTGGCGCAGATGCAGCGGTACAACAGCCGACGTTGACGTGGCCGCGTGTCGTCTCCTGCCGCTACTTCTGCTTCCACTGCGGAGGCGACACT
TGCTCGATCTTCCAGCAGGAATACTACAGGTACGGTAGGAGGACTTGGAGACTCTATGCAGGACGTATTCTACCTGGATCGAGATTGACAACGATCTATT
GTGCACAGAAGCCTGGAACTGGGAGGAGTCCAGGTACGGTCTCTCACTATGCGACGAGTGGAAATACATGGCAGCCACGTAATCATGGTCTACGAGCTTA
TTACAAGCGATCGATGGACCATTCTGGGAGTCAACTGCTGCCTTGTCTGTCACTTCTCATTTTGTGTATATGTGTTGTTAAATTTAGTCACTTCAGGGCT
TCCCCCACTGCTGCCCGGAGCGCTATTCCGTCGGTTCCAATTGCAGCTCTTCGCTGCATCTTCTCGTGACCTTTTCGGGCGACGCTACCGCGCTTCGACA
GAGCGATGAGCTGGCTGTTTGCTGTAGGTTTGAGCCCGTGGCTTCGGAGTCCGGCCCGTATGGGTCATCGCTCACAGTAGGGGAGATGGTGCTGATGCCT
ACTGCTGATCCATCGAGTCCATTGCCGTCTGCAAATTGGTTCGTCGGCAAACAGGAGAGCGAGAACAACCAACGCAAATTTCCAAAGGTTAGTTTATGTT
CTTTTTGTCAGCATGAAACACGGTATGACGATTTTGCATCTGATGTCGGTGTAGAGCGCGATCGTCTACGTCTTCAACGACTACCACCATCAGCAGGGGA
AGTGGAGGCTTATGGAGGACGAATCCGCTCTTGGTCCACGTGTAATGAGGGATCAACTTGTGGTTTATGTGCTCCAACCTCGGTCTCGCAGCTACGTTGG
ACAATTTCAAGGCGAACGACTCATCTATCGCGCACCAGGAGTCCTCTCGACTGTCATATATCGCTCTCCATCCCCACCGTTCAAGATCTTACCTTGCAGC
TCTCTGCGTAATCAGGTGCAACATAGCGCTATGGACTCGTCTTGCCAGTCTAAACGTCGACGTTCGTCTCAAGGCATTGAACATTTTCGTTTGGAAACTA
CAGGAGTTCCATCCGGCTGGTCAACAGCCTCGTTGAGTCCGGCAAATGAGCCTGGAAGTCCAAGAGAGTATGCCTGGCAACTGAACCGCCACGTTTCGGA
GCTCTCCTTCAGTGACAAAATGTTGCATC