Description :
From Genome Similarity Track
Location :
Scaffold_322:34764- 37414
Sequence
2650 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGT
AACACCTTCTACCAATGAGAGTCATTCAATAGATAGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCC
ATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTTCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAG
TAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTC
CAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCCCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAAC
GCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCGACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATG
TTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGTTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGG
CCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGATACTGCCAT
TACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCAAGGAGTTGGGCGTACGGACGCCGACTCACA
GATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCTGATCGAGGGCGGAGTTCCTCG
ATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGT
CGTCACGTTCATGAAGGGTCTTAGAGATGGATCCATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTA
GCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACTGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGC
GACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAATGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTG
CACGCGGCGAGAAGCCGTCGTGGCGATACCGGGTATCGCCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGAT
CGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAGATGACAAGCCGAACCTTGTCATCC
TGAAGGTTAAAGCTCGAAAGAAGAGAAGAAGTCCTCTTCGTGCTCCTAGCGTGGAGCTGTGGAGCGTCGAAACAACTTTGTTCGACTGCAGAAGCCTTCC
AAGGCTTGGACTTCGAGAGGTGGGAAACACCTCGGAAGTCTATTGGATAGTGAGCTGAGCAACGGGTGTCGTTGTTAGAACGAGAAGCCGTATCGACGCG
TACGCTTCTCTATACAAGAGAGATTCGTCGACGAGCTAATCGTCGCTGGAGCTGGACGAATATATTCGATATGTTGGGCATGCCGTGGCTTGCACGGCAT
GATCCGGTGATAGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCAC
GTGGTGCATGCGACCCTCCATCAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCGAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGAAGATG
TGAAATGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGGTAATGTCGACACACAATTG
GTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAATCGTCCCGCAC
CGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAGAACCCGCCGG
CGAATACAAGAAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGACAAAAGCTG
CGCAAGTCTCGGTCAGGGACTGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCGTA
CGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACG