Description :
From Genome Similarity Track
Location :
Scaffold_1100:3476- 8761
Transcript NameFunction/comments
Phyag_g9490callose synthase, putative

Sequence
5285 bases(100 bases per row)
cttcgagctgctgcagagcaagTTCGGgttccagcgcagcagcgtggccaATCAGAAGGAGAATCTGGGCTGCTGGATCACCAACTACCAGATGCGCGTG
CGGGCCGAGGCGCCGCAGGGAGCCGCCGAGTCCCCGGACTTTGTCACGCGCTCGGCCTTGACGCGCGTGCACAAGAAGTTTTTCAGGAATTATGTCATGT
GGACCAAGTTTCTACGCACGCCGCAGCGCTGCTCGGACCCGGAGAAGGAGAATACgaccaagatggagaaggaattagcgctctttttgctgctctgggG
GGAGGCCGGCAATTTGCGCTTCATGCCCGAGTGCATCTGCTTCCTGTACCACAACATGGCCGCTAAAATTGAATTTTTAGACACGCTGCCAGACGTAAAT
GAAGGATTTTACCTCAACGAGATCGTGCGGCCCATGTACCACGTGATCGCGAAAATGCGGTCGGCTACGGCGCCAAAGGGCAAAAGACCCTTTGACCACC
AAGATACGACCAATTACgacgacgtgaacgagtttTTCTGGACCATGAAGTGTCTGGAATGCGACGAAATGAACGTGGCAAAGTTTCTGGAGGTTCACGA
CCCGAAAACCTTCAAGGAGAAACGCAGCGTGTTTAATCCGCTCTTGGCGTTTTTTCGAGTTTGGTACTTTTTAGTCGTCATGTTCCACGTGATGGTGGTC
ATCACCTACGTGGCGTACATGGCCGAGGGAGACGATGATGGCGGATTGGGCTTTTTCTTCCGGGTTTTTAACAGCGGCCAGAACAAGATCCGAGCGCATG
CGTTCTACTCCATTTTCATCACGGTCACAGGACTGTTGGCtatgaaggtggtgctgcagattTGGCTGTTCGGATTGCGGCTGTATAAGGACATGTGGAT
GGCGGTGGGAGTGTTTTGCCGATTGTTGTGGCACTCGATCTTCTTTGGACTGTTCATGGCGGTTTTCTTCTCGCCAGATGGGTCGGGGCTGATGGGATCG
ATGAGTAGTATGCTGcctggaggaggaactgcTGGAACTTACTTGTCGATGGGACTGGTGTACTTGGCGATCTACAGCATCCCGGTGCTCACAGCGGCGT
TCATCCGCGCGTTCTTCCCGAATATGATTTGGGGCATTCGCATGGTGAATGCGCTTGATGGTACCAGTCGACAATATGTCGGACGCAACACGGCTCAGCC
GTGGGCGAACTACTCGCAGTACTCGTTGTCGTGGTttatcatcttcttctgcaagcTTCTGttcgcgctgcagttcatgATTCGTCCGCTGATGGCGCCG
TCGATTGAGATTTACGATATTAATATTGATGACAACGGCGTATTGCAGTCAGGACACAACATCATGTTCATCCTTGCACTGTGGGCGCCGATCTTcgtcg
tgtacatgtacgacgCCCAGATTTGGTTCATCCTGTACCAGTCCATTGTTGGTCTGATTATGGGCAAGCGGATGCACATTGGCCACTACGTTGGCCTGGC
CCAATTGAAGACGGGAATGGCAGGGGCGCCGAAGCTGTTTGATGAGAAGGTTGTGTCGCTTAGGACTAAGAAACCCAACCCAGAAGCAGTGACACCTGTT
CCTGGTGGCGGTGATGGCGGTGAACTGCGTCACCATGATGTTGTGCGCCTTCGTTTTGCGATCATTTGGAACCAAGTGGTCGACAATTTCCGCCTGAACG
ATCTGTTAGATGATCGCGAGACCGTTATCCTGCAGTACCGCATCCTAAACAAGGGCGAGCGTATCCAGGAGCcgatcttcttgctggcTGGCAAATTGTC
AAAGGCCGTTGAAGTGGCGGCCAAATCGCGTACCAACAAATGGGACACTGCCACGCTTGTAAAGAATATTGCTACTGCGGATGCACTGGAAGGCATGAAG
AACGGGATGGAGCTTATCCGCGATATCTTCTACTTGTTGCTCggtgaggaagaagaaaagggCGCTCTAAGCGTGTTGGAGTACATCTACTCGTCACCAG
ACATCGTGACTTTGCTCGACCTGACCTATTTGCCACAGCTGGCAGACAACAtggtcgagcttcttgcggtGATCTTAGATATGCCGGAGGATATTTCTGC
AATTGACACCCTGGATACTGTTCCGGAGGAGTTGCGCAtggagctgcacgtgcaagtcgctcaagtcgTTGACCGTTTGCGTGCCATCTCATTAACGCTA
GAACTGATGCTGAACGACGACACCGTCACGCGCAAACTGCATGACTGTCGCTTCTTGCAGGCCACAGCTGACCTGGAATTTCAGACCCAGCAACTCATTT
ACCTGTACAAGGCGGATGCTGCGGCTGAAACAGGCTTGATTGCTGTTCACCCTCGTGAAGGACCTGCTACCCCACCCCCGCGCTTTGCTCCCGAAGACTT
CATTTCCAGCTGCACGCGtctgttcttcttgcttcgCTTGGATGTTGCAAGCTCGCTTCCTCGTTGTGAAGATGCTAAGCGCCGCAtgggtttcttcttg
cacTCATTGTCGATGGAAATGCCCCGCGTAGACTCGATGGAGGCAATGCCGTCTTTCTCGGTGATGACCCCGTACTACTCTGAGACTGTGCTATTCACGT
TGGACGAGCTTAACAACCCAGTTCACGCGAACCCACTCTTTGCTGaactcgagaagaagcagaaactAAAGGGCTGGACGGAGCTGACGATCATGAAGTA
TTTGATCACGTTCCATGCTGAAGAGTGGAGCAACTTTTTGGAAAGAATGGGAGCTTCatcgctggaggaggcgcttgAAATCAACTCGACGGAGGTTCGT
CTCTGGGCTTCAATGCGTGGCCAGACTCTCGCTCGCACAGTTCATGGTATGATGTTGTACGAAGACGCAATCCGTCTTCTGCGTTGGTTGGAAGTGTATT
CACTCCATGACATGAGCATCCAAGAgaagttggaggagatgaatCGCATTTCGGCCCTGAAGTTTTCCTACATCACAGGTTGCCAGATTTACTCCAAGCA
GGTTGCGAACGGCGATCCTCGCGCGGCAGATATTGACTATTTAATGAAGAAGTTCCCGAGCTGGCGCGTCAGCTTTGTGGATTCGATCACGGAAAAGGAT
GGCGAGAAGGAAACCAACCGCTTTGACTGCGTGCTCGTGAAGGCTGAAGGCAACGAAATTGTCGAAGTATACCGATATGAGCTCCCCGGTAACCCAATTC
TTGGTGAGGGTAAGCCCGAGAACCAGAATGTGGCGCTGCCCTTCACGCGCGGCGAGTACTTACAGACTATCGATATGAACCAAGAACACTATCTGGAAGA
GTGTCTGAAGATGCccaacttcttggcgactGCTACCAGCACTGGTGAGGAAGTGACTGTTATCGGTATGAAGGAGCACGTCTTCACTGGCCGTGCTTCA
TCTCTGGCACGTTTTatgacgctgcaggagctggtgttcGTGACACTGACCCAGCGTGTGCTGGCCAAACCGCTTCGCTCGCGTATGCACTACGGTCACC
CGGATGTTTTCGAGAAGTCTTTCGTTGTCACGAGCGGTGGTGTGTCTAAGGCTAGTAAGGGTATCAATCTGTCAGAGGATGTCTTCAGTGGCTACAACGT
CACCCTTCGTGGCGGCTTGGTGACGCACGTCGAGTTCATGCAGTGTGGCAAGGGCCGTGATGTGACGCTGAGTCAGATCAATGCTTTCGAAGCGAAGCTG
TCAAATGGTTGTGCTGAAAGTTGTCTGAGTCGTGAAGGCCACCGCTTGACCAACTCGTTGGATttctcgcgcttgaattCTATGTTTTACGGTCACTTTG
GCTTCTACATTTGCAATGCCCTGACGGTGTTCTGCGTCTACGTGTACGCGTACTGTAAGCTATACGTTGCGACACACTCGGAGGTAGAGATCACGGCTAT
CACGAAGACGGGCAGTCTCAACTCGCTTGCCAGTGTGATGACAACGCAGTACCTGCTCCAGTTCGGTATGCTGACCACGCTGCCATTGTTCGCAACCCTG
TTCGTTGAATTTGGATTCAAGCAAGCTTCGCTCAAGGTGATTGAGCTGATTTCGACGCTTGGTATTGTGTTCTACGTGTTCTTGACGGGTACGAAAGCAC
ACTTCTACGATGTCGCACTGATTCGTGGTGGCTCCAAGTATCGCGGCACTGGTCGTGGTTTCTCGATCACGCGTGACCCAATGGTGAACTTCTTCAAGGA
GTACGGCGTTTCTCACTTCCGTAAGGCAGTTGAGTTGATCGGAGTGATGATTTTGTTTGGCATATACGGCTCGTTCGACATCGGTTCTGATGCGCTCGAA
GAGTACTGCGCGACTGCGGACTTCGACTGTGACAAGGACCCCGACCAGATCCCCGCAAATAtcacgtcgctggctgctttCAGCAATAAGTCGCAGAGCT
ATGGCATCGCCTCTTTTGCCGTGCTGTTCCTCGGTGCGTGCTGGCTGATGGCTCCGTTTGTATTCAACACGGACGGTTTGGTTCTTCAGAAGTCAAAGGT
GGATATCGCAAATTGGTTCGCTTGGATGATGCGAGCGCGTcacgaggacgacggcgaggaagaaACTAGCAAGGACGCGAGCACTGCTGCGTTGCAGCCG
AAGGATGGCTGGGACGACTGGTGGAAATCGGACGTGGATTTGATGTTGCCTCTGGGCGGAATGGGTCGTCTTACGTACTGCATTCGTGAGCTCCGCCATC
CGCTGGCGATGTACTACGTCTTCATGACAGAGTTCAAGCTTGCATGGTTTGCACTACTGTTCGGTGCCATGGGAGCCACATGGGTGTTGCTGTGGTTCGG
AAACCGCGTGCACCACTGTGTGTCAAAGCATCGCAAGCTGAACTCGCTCACGATCCAAGGCATTCTCTACATGGTGTGTGTCATTGGTGGCATTCTGTTG
ATCCCGCTGGTCCTTGGATCCATCGGCGGCTGGTCTGTGCTCAAGTGCTTCACGTTCTCCATCGCAATGATCTTGGGCTTTAACTCCATCGTGCAGTACG
CCCTTGCGTTCAACGGCGTCTTCGGAATGGAAGTGGCCATGTGGAGCCCCATGATGGCGCTTGGCTTCCTTATGGACATGCTCGTTGGTCTGTTCCTGGT
TGTCCCGCTGTTTCTGTTGTCTCTGCTTCCCTTCATGCGTATCCTCCAGACGCGCGCGATGTACAACGGTGGCTTCTCGCGCGCACTGAGCTCTGGCTCG
GAGGTGGCGGCTTCGCTGTGCATCTTGCTGGGTTTGCTGGGTGGCTTCATCCACGGCTTCACGACGTCGTTCCTGTACACGCTCG