Description :
From Genome Similarity Track
Location :
Scaffold_151:3476- 4746
Transcript NameFunction/comments
Hyaar_Emoy2811233hypothetical protein
Hyaar_Emoy2811234hypothetical protein
Hyaar_Emoy2811235transcription elongation regulator 1 (ca150)

Sequence
1270 bases(100 bases per row)
GGCTGGCGCTTCTGCATCTGCTGCATCATCATCTGTAACTGTCGAGGCATTGGTGGTGGTGGTGGTAGTACTAGTCCTGCATGACTAAATAGAGGTGGTG
GTGGTGGCGGTGGAGGTAGTGGTGGCACCATTGAGTTTTGAGGTTTAACCATTCGTTATCCCCTGGATTTTATTCCGCTTTTCTTCTTGCCCTTTTCTAG
TGCTAAAATCCAAAAATTCGGTCCTCCATGTCTGAGATTCGTCCCTCGCTTTTCGGAGTGCAAGCAGCATGTTCATTCAAGTATAAACTCTGACAATCTA
CGCAATCAAACGGGTGTTCCCTTCTTTCTCCAGTCAACAAAAACTACCACCAAACTTCCTCATCAGAGCCATTCGTCCAGTTCGGACCTCTTCATTCCAG
TGCCATCGACGTCGCCCCTCCACTACGTGCAACTCCCCAGGCACCACCAGCGCTCGCCTACCAGAATACGCCGCTTTCCACCTCCACCTCTCTCTTTCTA
TCGTACTGTCATAATTAATACCAGCTACAAGTGAACGCCCAGTACTGCATCAAGCAAGATGAACCACTACGCGCCGCCAGCCAATAGCGCAGCGTTCCCC
CGTGGCGCGCCACCGCCTTTTCGAGGCCCTCCACAAGCGTTTCCACGTCCCGGTTTGCCCCTTTTTCGTCCTCCATTCACCACGCGGGGTCCCCCACCTC
CATTTGCCTTTGCACGAGGACCATTGCCAGCTTTTCATGGACGTGTCATCCCTCCTGGACGATGTGGCCCACCCCCGGGGGTTGCTCGACTGAGCATCCC
ACGGCCAATGATGGCTACATTAGGGTTTCAAGCCCCTGGGTTACGACCAGTACAGAAGGAGGTTCGAGGTTTGGGACTCGTGCCGCCAGGATGGACGGAA
CACAAGACGTCTCAGGGGGTGACGTACTATCATAACCCGGTTACGGGTGTGAGTACCTATGAGATGCCGAGGATTAAAGAGACGGAAAAACGTGCTCGGA
AGTGGATGGAGTACAAGGACGAGGCCACCGGTGCTTTCTACTATTTCAATACAGTGACAAAAGAGACGATGTGGGACCAACCCGAGGAATTTCGGATGGA
GAGAGCTAGGGAACAAGTTGCCAAGATGAAGACGGAAGCAGCGATGCAAACGGCAGTATCGTCGCCGATAAGGGGACCTGCAGTTGCACCGACAGTAGCA
CCAGCTTCACAAGCTTCAGCTGTACTTCAGCAAGTACGTATTCCGGATCAAATTAGTGTGGCGTCCTCGG