Description :
From Genome Similarity Track
Location :
Scaffold_591:34754- 42746
Sequence
7992 bases(100 bases per row)
TATCTACCTATAAATACACTCAGTTTACATTCTACCTTAATTAGGTCACTTCGCTCTCTTTTGAATAAAGAGGGGGCCTGTGAACTGCCGTTCACTGAGA
GTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAG
ACTACCTGAACCTCTCCGAAGTTCGTTGCCATGGACAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCT
TCGGGATGGAGGCCCTGCAGAGCCCGGTGCTGTCAACACCGGCCGAGCAGCTCGAGCGCGTCAATGCGTTCGACGCGTACGAGCAGGGCCTCTTCGCGCA
TGTGCGGGAGAACCTGCACGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTGAAGCCGTATGAAGGGAAGGAAGGCGAG
AACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTTATCTCGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCG
GTCGTGCTAAGCGTTGGGTGTACACACGGGAAGCAACGTCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGGCGCGTTCCTCCC
GGCAACCTACGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGTGAGCAGCACGAGTACGTGCAAGAGATACGGGAGCTCACGGCG
TCCCTAGTGGGAAACCCACTCAATGAACACATCAAGATGACTGTGTTCATGGACAGCCTTCGAGTTGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGG
CAAGCACCCTTGAAGAGTCGATTCAAGTGGCTTTTCAAGAAGAGTACAGTCATCGCCAGGCGCGTACGCCGACCTCAGCGTGGCCTGGGAGCTCCTTGTC
GGCTCCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGATCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAAATGGGCCAC
TTCAAGCGCGACTGTCCCGCGGAAAGACTTTGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCTCTGGCAGAAGCCAGGATCCCGGGGACAGGGGA
ACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGGAGAACTAAGGCCTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGACTTAGCCCCTGAGA
GTCTTCGCACTCTAAGATCGGCGAAGAGCAGCGGCGGGCTGCTCGTAGTACACGGATGTGTACGGGGAACCGACCGTCCCTTTAGAATCTTGATCGATTC
TGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTTGTAGCAGCAACAAGTTGTCTGATGCTTTGAGAGAAAGCATAGGCAACGGAACGGTATCA
GTGCGACTAGTAGGAAGGAAGGTCGTTACTGGCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGGACAGTTCACCGCTC
TCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCACCC
TGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGTTGCCAGGGTACCAAAGCAGCCGGCAGATGC
TTGGGAGTCGTCAACGTATATGACGACTCCAAGGTTGTTTTGATGATGGCTGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACCTAGGTCCACAAGCGG
GTAGCTTAGTTCCGCTGACAGCTGCAGCTGCCACGAACACTGAGAGCAGCATGTTCAGAGTGGGTAGCAGAGTTCCCCTCACGGTCGCCCAGACCTTAAC
TGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCCTCC
TGTGTGGGTACCATAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGCCGACATCCCTAGACGTGGGCAGCAAAGCTCGACGTCACGGTCGCC
GTCGTCAACGACGCCGCCGCCGCCTCAAGTCGGATCCAAACTTCGTTCAGATCGACGTCGCCTCAAGCGACTCGAAGTCCAGGGCCCGGGCTCCTCCGAC
AAGGCCGGTGGAAGAGTGTTATCACTTCTTCGATGGCGAGACAGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTTCCAGAGGTTGCAGAG
ATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCCTGGCCAACCTCAAGGCTGGAGAGATCGCTGAGATGGTACTCATGAGACCTGAGACCCACTCA
GGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCC
CAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAATAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATT
GATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGG
CAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCT
GAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTA
GACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGG
GCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCA
TAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATC
GACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGCGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAG
CATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGTTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCC
TTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTC
CTGGCCCTGCCGGATGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGACGACACGGCTGGACAGG
AACGAGTCATCTCGTTCCAGACCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGGCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAA
GTTTCGCGTTCACCTTCTGGGCTCTCGGCCCTTCGTGATCTACACAGATCACGCATCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATG
GCGAGGTGGCTGTCCTTCTTCGCGGAGTACAACTTTTGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTCGCGGACGCCCTCTCTCGGCGTCCTGACT
ATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGCTCGGATACGCATGGCGTATCGGGGCGATGAGGCTGTCGCGCCTCTCGTCAAGTTCCT
TAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAAGGCCTCCTCTATTATCGGGTG
GAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGCTCGATATCCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGG
GCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGGCCTTCTGGTGGACCCACATGTATAAGTGGGTCGCCCGGTACGTTAAGACATGTGAAACATGTCAGCG
GGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCC
GCCGAGGGACACGGCAACACCGGAATGGTGGTGCTCGTGTGTCGTCTGAGCAAGATGGTACATCTTGCTTCGGTTTCCGTCACTGTTACGGGCGAACAAA
CCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTGCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAAC
GCTGTTCCCTTTACTGGAAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACACT
CTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCACTCAACAACGCGGTGCACGCGTCCACGGGGTTCA
CGCCGCTCTACTTGAACGGCTTCCGTCACCCCAGAGTACCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGC
CCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGTGGAATCCTTTATGGATTCCAAGCTGAGCGTTGTCAGCAGGGTCCGCGAT
GCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCCGACAAACATGGAAGAGGAAACTTAAATATATTTAAAGTGGGGGACTTAGTGTTACTAGACA
CGAGGAACCTACCTCTAGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTC
GTACACCATCGACCTGCCAAAGTCAATGACCCGACGTTCTATGCTGGACGTCTTAAGCGGTACTTTGATCAGCAGGGGGTTGCTGACTCGCAGACCCCCC
TTGTCCCAGCTCCTCGAAGCGAGGGTCGGTCACAGACGTCGACGACGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGAACGGCAAGGCTGCGGTCAAGA
CCGTACACCGGAGGGGCTCCGTACGGACGGACCCCGGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAGCAGAGCCTCGA
TCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGCAGAGGCCCGGCGAGCCACCCGGAGATGCAGGCTTCCGACCTCTCGCTCCAACAGGTCCAG
GCGGCCCGCAAGACGGGCGAGCTCACCCTGATTCCTGGCCTGGGCGGCAGCATCACCGTCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGT
TGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTTTCGGGAGGCGCCGAGTACTCGTACTCGTACG
AGGGCACCTCCGCCTCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCAAGGAGCAACGGCGTCGCGGTAAGAGACAGCTCCTCG
TGAAGTGGAGAGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGAGTGCCCGAAGGCTGTTCCCCATCTGGGGAAACAGAA
ACGGCCGTCAGCTTCCATAGTAGTTCCCGGCTTTCTGCCCGAAAGCGGTACGATGATAAATAAATCCGTACCCGCGCTCATCCTGAGCGCTGGAAGCCGC
GCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCT
TCATGGAGTTCCCGTAACTCCGTGGGTAAGTACTTAAGAGTCTCCACCCATGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGCTCTCGGGCA
TAACCCAGGGGTAGGATAGAGACCACCCCGGGTCTCGGGCTTCTACGACAAGTCGTGAAGTCCTAAGGGGGATGCGGTGTGGCGCGAGAAGCACACACCG
AGCAGCCTCCAAGTTGTCACGAATAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGACCGCCCACAAGGCCACGAGGAGCGA
CGATAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGGGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGA
ACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTTCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAGCGATAGCACCCTCCTCCTCCTCT
TCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGATGCCCCGATGGGAGTGCCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAAAGGCTGTAC
GCTTCTTTGAGTGCTTGGCGCCTTCGGCTTTAGAGACCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCC
ACCAGATTTGGGAGTGCCCTTAGCCGCCTTGACGGCCGGACTCTCAGAGCGCACAGACGTCCTGGGCCTGTGATCACCTTGATCACTAGCGAGCGACTGC
ACGCTGTCATCCTTGTGCTCACTGGGCACTGGGGCTGTGCCCTCCCACAGAGCCAGTAGGATCATCGTGCGTGCTCTCGGACTCGGCTTCGTCCTCACTG
CCAGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGGACGGTTGTCTGGAGAGGCCGAGGGCGACGGGCTGCGGCGCTTGCTTGCTTGCTTGCCCACA
GCCGCGTCACCCGAGGAGCCGATCGCCTCAGAGGCCAACTGAGTAGCCTCCTGACGTGCCGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCC
TCCCGGCAGCAGCCTTGGAGCGTGTCTTCGCACCGCTCTTTGCAGTGCCACGAGGCATGGTAAACGGTCGAAGTGAAGACCTAGAAGAAGAGCGCACAAA
CTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAAAGCTTGTGACGAACACC
TCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTATCCCTAGGTGTACCCTGGTTACACGAAGTGCTTCACACA
GAAGTATGCACAGTTGACACGTCATACTTTGGGATATTTGGTACAAAGTACCAAGGTCGTTCAAAGCCAGTCATTGGTTAACGGCATTGCATTTCTATAG
GTGACTTATAGTTTGTATTAAACCCAAGCTTTATCTACCTATAAATACACTCAGTTTACATTCTACCTTAATTAGGTCACTTCGCTCTCTTTTGAATAAA
GAGGGGGCCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCCGTCACA