Description :
From Genome Similarity Track
Location :
Scaffold_97:347535- 351252
Sequence
3717 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTCAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCACGCCACCGCGGGTAGACTA
CCTGAACCTCTCCGAAGTTTGTTGCCATGATAGGAACGACTTCTCCCATATACACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGG
ATGGAGGCCCTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGC
GGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCT
TCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGT
GCTAAGAGTTGGGGTGTACACTCGGGGAAGGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTTCCGAGCCGCGTTCCTCCCG
GCGAACTACGAGTACCGGCCAGCGTTCGCGCTTCCTCGCGTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCATGCGCAGCTGCG
CGTATCACGGGGATCTAGCCCCTGAAAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCAGCGGGTGCTCGTAGTACACGGATGTGTACGGGGATACGAT
CATCCCTTTGGAATCTTGATCGATTCTGGGGCGTCGAAAGAATTTTGCGCCACGCTGCCCAGACGGTTGCTCGCAACAGCAACAAGCTGTCCGATGCTTT
GAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCATCAAGTTTGAA
GACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGACATGCCCTGACTTGAGAAGCACGAGCCCTGGATCGACT
GGCGAGGCAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTCAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGC
TGCCAGGGTACCAAAGCATTTGGCAGATGCTTGGGAGGCGTCGACGTATATGACGACTCCGAGGATGCTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTG
GCAAAGTGGGTATCTTAGGTCCATAGGCGGGTAACTTAGTCCCGCAGACAGCTGCAGCTGTCACGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAG
AGCTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAAGGCGTCGAACACGCTTCCTGTGTAGGTACCACAGCACCACACGAGGCAACGAGTGCCTC
GGATGTCGTAGCGCCGACATCCCTAGACGTAGGCAGCAAAGCCCGACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGTCGGATCCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGATGCGAGAGAGCGACAATCC
CGCTCAACGCGGTAAGCACTCCAAGTGGCATGCTTTGGGAGTGGCTCGTCATGCGCAGGGCTTGTCTAACGACCCGGCGACGTTCAATCGCCTGGTGACA
CAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTTGACGACATATTCGTCCATAGCCGTGCCGAAGGAGGCAAGACGGCCATGGAAGTGCACC
TAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAATATCGACAAGTGCGCTTTCGCGTCACCAGAGATTAATGTTCTCGG
TTGCTTCGTATGCAACGTGGGCGTTCGGGCTGACCCAGACAAAGTCAAGGCCATAGCAGCATGGCCGATGCCCCGATTCCAGAAGGATCTTCGAAAGTGG
TTAGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTCCGCTAAGCCCTTGTCGAGTCTCCTTGAGAAGGACGTCGACTGGCGCCGGG
AGCAGGAGCAGTAGGATGCTTTTGACAGCATCAAGGCCGGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTG
GGATGCCTCCGATTACGCCATCGGATGTGCATTGGTGCAGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGGCAACTCAAAGCCGCC
GAGCGGAACTACCCTGT