Description :
From Genome Similarity Track
Location :
contig_36:347514- 352159
Transcript NameFunction/comments
g9219.t1hypothetical protein

Sequence
4645 bases(100 bases per row)
TCAAATGCGGAGCTGGTCTGTGGGGCTGATGCCTGTCCAGCCCGTCATCTCCGTGTCAGCGAGACGGAAGTCGCCGTCCATTTCGACGCAATTGCGGACG
GCGTACAGTAGTTTTTCGCGACAGATCTCATCGCTCGAGTATCGAGGCAGTTGCAGTGCAAAGAAGCACGTGTGCGACTTGGGCATTTGCGAGTCCATCC
ACCCGCCAGAGGTTGACGCCGCTCCGCTTGACGAACTGCTGTCTCCAGTCCCCGAAGACGCAAGAGCTTGGATTTGAACTTCTGTGGAACTGAGCGGAGC
CCAGAGGCAGACGCGATCGGGCCCACACGAACCGCAAGAACGCACGCTTGTCTTCGGACTCGAGGCCTTCGAGCACTCGCCAGAAGCGCTGAATGAAGTC
GTCAGTAGCTGAGAGCTCTTCGTCGTATTCCGTGTTGGCCTGGAGGAGCTTCACGTCCACCTCTGCGACGCCACACATGCGTTTCTCCAGCTCAGTCCAC
GTCAAGAGAGCTAACGCTGAGATCGGCATGATCGAGTGCAGCCCCTGCTTGACGATGTTCATCACCTTGTGTGTCTCTTGAACGCGAGCTCGCAGCATAG
CGTCCAGGTATTTCTCCAGATTGGCCAAGGTGACAGCAGTATTGGTGCCGTCTTCGCACACTCGACGGTGCGTCCATCGGACAGCACAGTCGTGAAGACC
AAGTCCATGGCTTCCAGCTGCTCTTCCAACTGACGACGTTTTGTCGATGCTGTAGCCTGAAGACGTTGAGATCGTCCAAAATGCCTCGCAGCGTCTTCCA
GAGCGAGTACGCGACAAAATCGATCTCTTTCAGCGTCTCCAGTGCGTTCTCCGGGTTTGAATCATCCTCGCCCACGAGCTGTTTCCACACCGACATTGCC
AGATCGAGGCGCACACAGACTCGAGTTCGTAGGCAAGTCCCAATCATCTGACCAAGGAAGTAGAACATCTCGCAGTAGAGCTGACGCTTCTCTTCTGCGC
TTTCTCCTGCTGAAGAACGCACCCTCGCTGATGGTTTACCAGCATCTCCAGCGTGACGAGTGATTAGCGCACCATTCAGTACAAACTTTTCTCGGCTCGC
TCCAACGCCGTTCCGCCAGTTTGGACTAGGCATGAGGAACGGTAAAACACACTCCGAAACAGCCACGCCTGCCTCCAATTTCAACGACGTGCTACTGGGT
CCTCCGTTCACTGAGCTGTCCGCATTGTTTTCGGAGTGGGTTCCGCCTTCCGGTACGTGCAGCATCTGCAACTCGGCGAAGAACTGCGAGAAGAACTCTC
GGTACGGACCACCGTAGTCATCGACGCCTTCTCCCTCGAACTTGACCTTAAAGCTGCGCAACTGGCCGTCATCCATCGGGTGCGAGTACACCATGCGCTG
CGTCCTAACTGGCAAGAAGTGGAGTTCTTCAAACGCCTGGCCAAAGAGCGACAAGAAGAGCTGCTGATGGTCCCCTCGTGGCATTTCGCCGCTGCAGCTT
TCAGGCGGTTAACCTGCAGCTGTGGTAGATCTTCAGGGTAGTCGTACTCGTCATCCGCTCTCTTGGGCGAATTCGCCGTCCTCTCCATCAAAGCCGTGAA
GAGAGCATTTTTCACGCAGACAAAGAGACTCCCGCGACACTGAGAGATCAGGCGACAAGGCAACGAGGTCGAGGTCCGCAAGAAGTAGTGCCACGTGAGA
TCAAAGAACGGCAAGGCACGGCTCACGTACATGTTGGAGTAGCGCAGCAGGGCAAAGCGTGCAGTCACCATTTTGTCGCGCTTCTCCTGCGGCAGTGCAA
GCACACTCGCCACGGACGTAAGCTCCAAGGCGGGCGTTTTCTCCTTGACGAGATTGACAAGCTGAGCTGGTGTCAGATTCCAGGGACTCGTTTGTGAGAC
CTCGCAGAAGTCGTTGATAACACTCAGCAGGTCTCTATCCACCGTGAGGCTCCAAAGTACATGCTCACCATACTCAACGAGCTCTTCTTGTGAAAGCACA
AACGATGATACTTCCGCTTGAATGGTGCTGTCAGATGTCACGGAGCTCGAATCAATACGCGGCGGTAGTGGGCTTACTACAGACTCCGCGGGAGGTGTGG
GCAATGTACTCGTCGTCGAGCTGGCCATTGTCACTAGCCGCACTTTTGACGGATGGAAAAACCACGCTCCAGGCTCGTTGTCCACTTCGACCCACATTCT
TCCAGCTGCAGCGCCCACGACAAGACCATTACCACGGGGCGTCCGAACCCGGTCGTTAGCGTAAAACCCAAGCTTGCCACACGTCTCTCGGGTGACGTCC
ACCCACAGCGACTTGCCCGATCGCGTAGCTACAAACTTTGTCGACCCAGCGAGCCATTCGGTGGTCATTTTGGACACTGCAGCGCACATCGCGGGACGCA
ACGGCTTGTTTGCCACCCAGTTGGCCATGATCTCACAAGCGACCAAACAGTCCTCGACACTGGCGCTGGCGTCTTCACCCGTTGAAGACATGTGGCTGCT
GACACAACTGTCTTTTGCGAAGGAGATCTTCTGGTGGCGCGAGTAGAACGCAACGGCAGGACACACTTCTCCAGCGATGTTGTCGAATGCCAGCCCGAGA
TCCACGCCATTCTTACTGAAAGACAGCTCGCCCTTCTCACAGTCTAAGCGCAAACCAATGCAGTCGCCTTCGGTGAAGGTCTCGCCATACGCTCGCACTC
GGTTGCGTTGGTAGTACAGTGCCTTGTCGCCGATGAACCCCCACGACTGATCATCAGCTCCAAGAAACGAATCGAGGTTGGCTTGTCGAGTTGCAACACC
AACGAAAAGGTAGGGAGAGCTGGACTTCTCGATGCGAACCACCCATGAATGAACTCCCGTGGAGAACCCCACGCCAGCGCACGCTGCCTTCCAGACTTCA
TTGCCCGAGTATGACACACTCAAACCATCTCTGCAAACGCCAGCAAACTGCTTCGGCTCCTTTTACGATCAAAGTGCAGCGAACTACCCTCAAGTTTCGG
GTGAATCGGAGCGGTAGGAGGTGGCTGGGAGGAATAATCGCCACTTCCACCAGCGTCCTGTGTTAAACACCGGGCCACTGCAAGATCACTGAATCCCGTG
CAGCGTTGCAGAACATGGAGGAGCTCCACGTATCCTTGGAGATACTGCGAGAAAAGGAGGCGTCCTTGAACCAGTTCTCGACTGTGCCGCAGAATTGCTG
CTGTCAAAAACTCCCCGACAACCAGTTGCGCCTCGTTTACTATCTCGGACGCTTGGCCGACACTGCCTTCACTAGGAAGGGTAGACAGCAGTCTGCTGAC
CGTCCGCAGCACTACAAACTTCAACGGGAGATTCGTCGTGCCGAGACAACCTCGCAGTCGACGTAGGATAGTCGTGGTAAACCCAGCAGAAAGAGATAAT
AAAGTACTTCTCGTGGCCCCTGCCAGCAGAGCGTCCAGTATCCAGATAACTGTTTCGATTCCAGGTTCCTCCGCCACAGTCTTGTCCGGTCGTTTGAGGT
CTCTCTGAGTCCACAGAACAGCTTCGTACCTCTTGCTCGATGCGGCAGCCTCCAGCTCGCTAAGACAAAGCTCTAAGGCGTCTGGCACGAAGCGGCCTGC
GTCCTGATCCACAAAACACTCAAACGCTTTTGAAAACACTTCATCAACCGAAACCTCTTTGAGCTGCGGGGTCTTGTTGCTCCTCGAAATGACTGTAAAT
TGGTCACCGCGCAGTAGAACCAGCTTCAGTAGCTTGAACCATTGAGCGTACGAGATCGTTAACCGAGCGATCGAGCCCGTGGTTTGATGCAGTAACGTCA
TCATGCACTGACGGGCATAAAGAATGGATAACGTTCTCTCAAACGTTCGCAGTTGCTCAAGAAGTCCTCTGAGATCAAGTTGATTGAGTTCTGCCTGGAA
ATCCTCTTCAAATGGAGATCGTGACGTCTCAGGTGTGTTGTCAGCAATAGGTTGCGGAGAAGACGGCGCAGTCCTCGCTTTCATTTCGATTGCCTCAGCT
CTCCACGAGCGCATGAACCGCGTCTTGGTATTTGAAAGGTAGCCTCCATCTTCGAAAGGGAAGTACATTTCCCCAAACAGTTTCCGGCCCATTTCCTTGT
CATTCAACGGTGGCACAGTGACGCTATCTCCTTCCTGCACATTGAAACTTGATACCACAGCCTTCGTAGGCGAGTCGCTGCTAGTGTGAGTGTCGTCCTT
TGCGAGTTCCGAGTCGTTTTCACTCCAGACGGTGGCCTGCAGCCAACTGTTGGAAGAATTCAACGGTGGAGGCTGAGTAGAGGCATTTGCTGTATCGTCA
CAAGGCACAACATCGTCTTCTTCTTCGTCGAAGCGAGGTGAATCTCGTCCTTTGTCCCGCTCCTTGTCTAGCGTAGACTGCAGCTTGCTCAGATACTCTA
GGTTGTCAACGATCCAGGCTGATGCACTCACGATGTCATTTTCTGTTTGCTTCAACGCCAAGACACACCAATCTTCTGGGAATCCCATCAGCATAAGCTC
TTCGACGAATTCGGCTCGGGTCTCCTCTGCGTCGTCGTCATCTTCGTCGTCATTGTCAGCATCGTCCAGGCTTCCCTCATCGTCTTCGTCTTCATCATCG
TCATCCTCATCATCGCCATCTTCGTCATCGTCATCATCCTGGGCA