Description :
From Genome Similarity Track
Location :
Scaffold_248:34751- 39006
Transcript NameFunction/comments
Albla_Nc14107500structural maintenance of chromosomes protein 5 puta
Albla_Nc14107510structural maintenance of chromosomes protein 5 puta
Albla_Nc14107480structural maintenance of chromosomes protein 5 puta
Albla_Nc14107490structural maintenance of chromosomes protein 5 puta
Albla_Nc14107470structural maintenance of chromosomes protein 5 puta
Albla_Nc14107460structural maintenance of chromosomes protein 5 puta
Albla_Nc14107450structural maintenance of chromosomes protein 5 puta

Sequence
4255 bases(100 bases per row)
ACGAGCATGACGTCTGACGCCAATGGCGATGACTGGAGTATGTCTTCGTGTGATGAATACGTTGATGGCTCAATATACCGTGTTAAGCTCCACAACTTTC
TTACCTATAATGATGCCGAATTTCACCCTGGTCCGCGACTCAATCTGATACTGGGTCCCAACGGCACAGGAAAGTCTTCTGTTGTCTGTGCACTCTGTGT
CGGCCTCGGAGGCAGTACGAAAGTATGCAAATATAAACTCGCTTATATTAGTAGATATCAGCGCCGGTAAGAGTGAGAATTGTGCTCAAGATTGCTGTAT
AGGTTCTTGGACGTGCCGATAAAGTGGGTCAATTTGTTCGTCATGAAAAAGAATCGGGTTTTGTTGAGATCGAGCTGTTTTTTGGAAGCGGCAATTCGAT
CATTCGGCGTATAATACAACGTGATCATAGAAGTACTTGGTTTTTAAATGGTCGTGAAGCTACCTACAAGCAAATTCTCCAGCTGATGGCAAGGGCGAAA
ATTCAAATTGATAATTTGTGCCAATTTCTACCCCAAGACAAAGTTGGAGAATTCACACAAATGAATCGGATGCAGCTGCTAAATGCGACGGAGCAAGCAG
TATTGAATGGTGAATTAGCGACAACTCATGAAGAAATCGTTCGCATGCAACAAGAAATGCACACGAAGAAAAAAGTCTAGATTCTATATATGCATACACG
TGTGCCAAGCTAATTCAGTATGATTTATAGGAACTCTTACGCGCAAAACAAGCACTTGACCTGAAGAAAAGCGAAAATCAACAACGAAAAGTCGAAGCGA
AGCGTATAATAGAGCACGAAGATCGTATCAAAGAGGTGAAATTTCGCTCACTTTTTGGAAGAAACGACGTGACTACTATGGTCTACGATCTCACTAGACC
GAATTATTGGAAAAGAAGAGTATGTGGGTTGAGTTTCACAATTATAAGGCCCAAGTCGAAGTATTGAAAGCGACCAAAAAACGCTGCCATCAAATGCTCG
AAGTAACAAATTTCACTAGGGTAACTTTTTGATCTGATACAACGTCTGCACTGTAGGATGCACAACAGGTAAATGTTCTCCCACTACAAGAACGTCTCGA
GAAAGAAAAGATCCGTCTTGAAGGCTTGGAAAAAAAGTAGTGAAAGCATTTGTATCTTCGTGCTTGCTTATCTTACTAAAGTCGAATTGGCATATAGGAA
GAAGCATTTCGAGCAGCAGAGGCGCCAGGAAGAGGATAGAATGGTCCGTGAAAGGACTGCGGTGAGTTTTCGGCGCTTATCCCATCAACGATTCTTCTTT
AACTTTTGGATCAAATATGATTGCAGTCTGAGCAGCTGGAGAGCGAACAAAGTCGTATTCTATCGGAAATCGAGGAGATTCGAAATCATCATCAGGAAAC
TCAGCAGAAGGTTCTGAGACTGGAACGTGAATTGAATGAAGTATGTCTAGAACTGAGTAAGCTAAATATAATAAGGTGACACTTGTGCTCGAATAGTGGA
TAGAAGAACAATCACAACTTCCACCTGAAGACCTTATCAAAAGAAAAAAAGTTGAAATTGAAAATGAGCAAAGGTCACAAGAAGCAGAGGTATGAGTTGC
GGAATATTTCAATTATGAAAACTGAGATAAAATATCAACGAGGATAGCGCGCGGAAGTTACCACTGAGCGCGAAAGCTGCGTTCGAAGGGTAAAAACCTC
TCGTTTACATCTTCTCTGGTCGATGTCTCATCAAGAATTAGCTCTTTACAATGGAACAACAATCCGGAAGAATTGTATCGCAACTTGCGAAACTAGAAGA
TGAGATTGTCCAACGCCGTCTTGCCATACAGCGATTCGACCCGGACTCTATTCGTGCCTTAGACTGGGTAGATCAGAACCGGAGCAAATTTAAAAGGCCC
GTATGGGGTCCCGTTGTCTTACAGGTGCTTTCAATATTCAATGTCAAAAACAGATCGTAAGCCTCATCTTCAACACAGTTGACCGTGAAAGAATTGCTGT
ACGCAAAATTCGTCGAAGATACACTTCCGAAGTGGCTCATGACAGCTATAGTGACCGAGTGCTACGAAGACTATAACACTATAATTCATGAACTGCATTC
CGGTCCGACAGATCAACGTATCAAAGCTTCAGTCCTTATTGTCCAAGATGGACGTTGCAGCAAAATTAATCGACCGTACGGCTTCGATCGAATGCGCTCA
CTCCAAAAGGAATATGGAATTATCGGCTATTTGGACGAAGTATGCTTTCTTGAGTATCTCCATCTTAGACAGCAGCAGCCAGTTAAAATTCGATATATGT
AGCTGATTACGGCTCCTGATATCATCCAAGAAGTATTGCGCGTTCATGGTGGAGTGCATACAGTGTTAGTCGGCTCATTAATGACCGAAGATGCAATCAA
TCGAGGGGTAGACATCTTCTCTAAGCTGTCCTCCCGTGAAAAGAAAGTTGCTTTTGTCACACCCAAGAAAAAGTACGTCGTATCTGGTAAGTGAGCTCTC
ACAACCCACATAAAGGGTTCTCATGCTAACCACACCACACAGTATCAAGATATGGCAACGGGAATGTCACAACACGAACAAACGATCTTCAAAACCCTCG
CTTACTTGCAGCATCCTCATCCAATTCAGAAAAGAAGGACGAGCTATCTGCAAACTTGAAACATCTTCAAAATGAAGTCAAAACAGTTCAAAACAAGGTA
TGAAGAGTTGTAGCATTACCTGATCTAGACTGATCTCCTTTATCATAGATCCTTGAGCTGAAAGAAAAAGAAAAGAGTGCCGCAGAAGCTCGAAGTGCAT
CCTTACAGCATATCGCCAAACTTCGCACGCAACTAGTAAATATTATGCGAATGGAAGAGAGGATTGTCGAAGCAAAACGCAGAGTGGATTGCCTACGACG
AGATCTTGATCAAGTGAGTATTCATTGCGAGCTTTAAGGCATTACATTTTTCATCCGTCGTTCTGTAGGATTTATCAGTCAAGAAAAAGGATGCATTGTC
GAGGCTTCGAAAGCTTCTTGTCGAGTACGCTTTCCAACTCGGTAACATTATATTTGCGTATGCTGACACTTACTTTGAATGTAATTACAGGCAAGGCTCT
CAGCTTGAGAAAGGTTTAACGTCAACGAAGAAAGCTTACAGAGCAGCTGTCGAATACACCTCAGCAAATTTCTGCTGTAATGCACAACAACTTCGGGTGA
ATGGCGTGACTCAATGTTTGAGACAAGCAGTGCTAAAAATCTGGTTGGTTCTGCTCTTTCACGCCACGATTCAAAGCAGCCAGCTTGACTCGTTTCTGTA
GCGATTTGCGGCAAAAATATGAGGATTCCAAGGAACAGCTTTTATGCGCCGCAAACGAAGCGGTGCAGCTCAAGAAACGAGCAGAACGTCAAGCCCCTTG
GGAGACATACGAATCTCAATTTGAGCAATCACCCGATGATTTAGAGGAACTTCGCGGTCTTATAGAAAGCAATAAAGCATCGTTGGAGTGTTTCCGAGGT
GATACACGCATTCTGAGCATCTACCGACGCGTCAAAGAAGAAATTATCAATGAAGAACATGAGGTTGAAGAACTCCAAGCGATCACACAAACTGAAGGAG
ACGAAATCAACCAAATTCGGGTGGGTAGAAACTGAATCGATTCATCCAATCTTTCGATTGTGATGAGTTACAATCTTAAATCTTACAGGAGTCTTGGCAC
GCTCAACTTCGGGCTGTTGTGGAAGAAATCGACCGAAATTTCCAAGAGTACTTCAAAGATATTGGATGCATGGGAGAAGTTGTTCTAATCGACGATGATG
AGGTACAAATGCAGTGTCGCGTTTCAATGAGACTCAGCCCTGCCGAAATCAACGTAGGATTTGACCAAGTGGGGGATCGAAAGACGGGCACAATTTCGGA
AAAATGCGAGTTTGTCCATCATGACATCAGAAGAGCAATCCGGCGGTGTAAGGCGCTTCTTTTTTGTCTGATGCTTATTGAATGAATCTTTTGTCAACGC
ACAGGAAAAATCTGTTGGGACTATAATGTACCTGATGGCAATCCAAAATATGACTTGCTGCCCATTCCGTGTTGTGGATGAAATTAATCAAGGAATGGAC
GTGTACAATGAAAGAAAAGTGTTTCATCGGATAACGAAAGCATCCTGTGGGAAAAAGCTTCCTCAATACTTTCTGATTACTCCGAAATTGATCACAAAAC
TAGAATATCATCGCGACACCAAAGTTATGGTCATTTTGAATGGACCGTTCAACAA