Description :
From Genome Similarity Track
Location :
contig_36:347507- 352152
Transcript NameFunction/comments
g8803.t1hypothetical protein

Sequence
4645 bases(100 bases per row)
TCAAATGCGGAGCTGGTCTGTGGGGCTGATGCCTGTCCAGCCCGTCATCTCCGTGTCAGCGAGACGGAAGTCGCCGTCCATTTCGACGCAATTGCGGACG
GCGTACAGTAGTTTTTCGCGACAGATCTCATCGCTCGAGTATCGAGGCAGTTGCAGTGCAAAGAAGCACGTGTGCGACTTGGGCATTTGCGAGTCCATCC
ACCCGCCAGAGGTTGACGCCGCTCCGCTTGACGAACTGCTGTCTCCAGTCCCCGAAGACGCAAGAGCTTGGATTTGAACTTCTGTGGAACTGAGCGGAGC
CCAGAGGCAGACGCGATCGGGCCCACACGAACCGCAAGAACGCACGCTTGTCTTCGGACTCGAGGCCTTCGAGCACTCGCCAGAAGCGCTGAATGAAGTC
GTCAGTAGCTGAGAGCTCTTCGTCGTATTCCGTGTTGGCCTGGAGGAGCTTCACGTCCACCTCTGCGACGCCACACATGCGTTTCTCCAGCTCAGTCCAC
GTCAAGAGAGCTAACGCTGAGATCGGCATGATCGAGTGCAGCCCCTGCTTGACGATGTTCATCACCTCGTGTGTCTCTTGAACGCGAGCTCGCAGCATAG
CGTCCAGGTATTTCTCCAGATTGGCCAAGGTGACAGCAGTGTTGGTGCCGTCTTCGCACACTCGACGGTGCGTCCATCGGACAGCACAGTCGTGAAGACC
AAGTCCATGGCTTCCAGCTGCTCTTCCAACTCACGACGTTTTGTCGATGCTGTAGCCTGAAGACGTTGAGATCGTCCAAAATGCCTCGCAGCGTCTTCCA
GAGCGAGAACGCGACAAAATCGATCTCTTTCAGCGTCTCCAGTGCGTTCTCCGGGTTTGAATCATCCTCGCCCACGAGCTGTTTCCACACCGACATTGCC
AGATCGAGGCGCACACAGACTCGAGTTCGTAGGCAAGTCCCAATCATCTGACCAAGGAAGTAGAACATCTCGCAGTAGAGCTGACGCTTCTCTTCTGCGC
TTTCTCCTGCTGAAGAACGCACCCTCGCTGATGGTTTACCAGCATCTCCAGCGTGACGAGTGATTAGCGCACCATTCAGTACAAACTTTTCTCGGCTCGC
TCCAACGCCGTTCCGCCAGTTTGGACTAGGCATGAGGAACGGTAAAACACACTCCGAAACAGCCACGCCTGCCTCCAATTTCAACGACGTGCTACTGGGT
CCTCCGTTCACTGAGCTGTCCGCATTGTTTTCGGAGTGGGTTCCGCCTTCCGGTACGTGCAGCATCTGCAACTCGGCGAAGAACTGCGAGAAGAACTCTC
GGTACGGACCACCGTAGTCATCGACGCCTTCTCCCTCGAACTTGACCTTAAAGCTGCGCAACTGGCCGTCATCCATCGGGTGCGAGTACACCATGCGCTG
CGTCTTAACTGGCAAGAAGTGGAGCTCTTCAAACGCCTGACCAAAGAGCGACAAGAAGAGCTGCTGATGGTCCCCTCGTGGCATTTCGCCGCTGCAGCTT
TCAGGCGGTTAACCTGCAGCTGTGGTAGATCTTCAGGGTAGTCGTACTCGTCATCCGCTCTCTTGGGCGAATTCGCCGTCCTCTCCATCAAAGCTGTGAA
GAGAGCATTTTTCACGCAGACAAAGAGACTCCCGCGACACTGAGAGATCAGGCGACAAGGCAACGAGGTCGAGGTCCGCAAGAAGTAGTGCCACGTGAGA
TCGAAGAACGGCAAGGCACGGCTCACGTACATGTTGGAGTAGCGCAGCAGGGCAAAGCGTGCAGTCACCATTTTGTCGCGCTTCTCCTGCGGCAGTGCAA
GCACACTCGCCACGGACGTAAGCTCCAAGGCGGGCGTTTTCTCCTTGACGAGATTGACAAGCTGAGCTGGTGTCAGATTCCAGGGACTCGTTTGTGAGAC
CTCGCAGAAGTCGTTGATAACACTCAGCAGGTCTCTATCCACCGTGAGGCTCCAAAGTACATGCTCACCATACTCAACGAGCTCTTCTTGTGAAAGCACA
AACGATGATACTTCCGCTTGAATGGTGCTGTCAGATGTCACGGAGCTCGAATCAATACGCGGCGGTAGTGGGCTTACTACAGACTCCGCGGGAGGTGTGG
GCAATGTACTCGTCGTCGAGCTGGCCATTGTCACTAGCCGCACTTTTGACGGATGGAAAAACCACGCTCCAGGCTCGTTGTCCACTTCGACCCACATTCT
TCCAGCTGCAGCGCCCACGACAAGACCATTACCACGGGGCGTCCGAACCCGGTCGTTAGCGTAAAACCCAAGCTTGCCACACGTCTCTCGGGTGACGTCC
ACCCACAGCGACTTGCCCGATCGCGTAGCTACAAACTTTGTCGACCCAGCGAGCCATTCGGTGGTCATTTTGGACACTGCAGCGCACATCGCAGGACGCA
TCGGCTTGTTTGCCACCCAGTTGGCCATGATCTCACAAGCGACCAAACAGTCCTCGACACTGGCGCTGGCGTCTTCACCCGTTGAAGACATGTGGCTGCT
GACACAACTGTCTTTTGCGAAGGAGATCTTCTGGTGGCGCGAGTAGAACGCAACGGCAGGACACACTTCTCCAGCGATGTTGTCGAATGCCAGCCCGAGA
TCCACGCCATTCTTACTGAAAGACAGCTCGCCCTTCTCGCAGTCTAAGCGCAAACCAATGCAGTCGCCTTCGGTGAACGTCTCGCCATACGCTCGCACTC
GGTTGCGCTGGTAGTACAGTGCCTTGTCGCCGATGAACCCCCACGACTGATCATCAGCTCCAAGAAACGAATCGAGGTTGGCTTGTCGAGTTGCAACACC
AACGAAAAGGTAGGGAGAGCTGGACTTCTCGATGCGAACCACCCATGAATGAACTCCCGTGGAGAACCCCACGCCAGCGCACGCTGCCTTCCAGACTTCA
TTGCCCGAGTATGACACACTCAAACCATCTCTGCAAACGCCAGCAAACTGCTTCGGCTCCTTTTACGATCAAAGTGCAGCGAACTACCCTCAAGTTTCGG
GTGAATCGGAGCGGTAGGAGGTGGCTGGGAGAAATAATCGCCACTTCCACCAGGGTCCTGTGTTAAACACCGGGCCACTGCAAGATCACTGAATCCCGTG
CAGCGTTGCAGAACATGGAGGAGCTCCACGTATCCTTGGAGATACTGCGAGAAAAGGAGGCGTCCTTGAACCAGTTCTCGACTGTGCCGCAGAATTGCTG
CTGTCAAAAACTCCCCGACAACCAGTTGCGCCTCGTTTACTATCTCGGACGCTTGGCCGACACTGCCTTCACTAGGAAGGGTAGACAGCAGTCTGCTGAC
CGTCCGCAGCACTACAAACTTTAACGGGAGATTCGTCGTGCCGAGACAACCTCGCAGTCGACGTAGGATAGTCGTGGTAAACCCAGCAGAAAGAGATAAT
AAAGTACTTCTCGTGGCCCCTGCCAGCAGAGCGTCCAGTATCCAGATAACTGTTTCGATTCCAGGTTCCTCCGCCACAGTCTTGTCCGGTCGTTTGAGGT
CTCTCTGAGTCCACAGAACAGCTTCGTACCTCTTGCTCGAAGCGGCAGCCTCCAGCTCGCTAAGACAAAGCTCTAAGGCGTCTGGCACGAAGCGGCCTGC
GTCCTGATCCACAAAACACTCAAACGCTTTTGAAAACACTTCATCAACCGAAACCTCTTTGAGCTGCGGGGTCTTGTTGCTCCTCGAAATGACTGTAAAT
TGGTCACCGCGCAGTAGAACCAGCTTCAGTAGCTTGAACCATTGAGCGTACGAGATCGTTAACCGAGCGATCGAGCCCGTGGTTTGATGCAGTAACGTCA
TCATGCACTGACGGGCATAAAGAATGGATAACGTTCTCTCAAACGTTCGCAGTTGCTCAAGAAGTCCTCTGAGATCAAGTTGATTGAGTTCTGCCTGGAA
ATCCTCTTCAAACGGAGATCGTGACGTCTCAGGTGTGTTGTCAGCAATAGGTTGCGGAGAAGACGGCGCAGTCCTCGCTTTCATTTCGATTGCCTCAGCT
CTCCACGAGCGCATGAACCGCGTCTTGGTATTTGAAAGGTAGCCTCCATCTTCGAAAGGGAAGTACATTTCCCCAAACAGTTTCCGGCCCATTTCCTTGT
CATTCAACGGTGGCACAGTGACGCTATCTCCTTCCTGCACATTGAAACTTGATACCACAGCCTTCGTAGGCGAGTCGCTGCTAGTGTGAGTGTCGTCCTT
TGCGAGTTCCTCGTCGTTTTCACTCCAGACGGTGGCCTGCAGCCAACTGTTGGAAGAATTCAACGGTGGAGGCTGAGTAGAGGCATTTGCTGTATCGTCA
CAAGGCACAACATCGTCTTCTTCTTCGTCGAAGCGAGGTGAATCTCGTCCTTTGTCCCGCTCCTTGTCTAGCGTAGACTGCAACTTGCTCAGATACTCTA
GGTTGTCAACGATCCAGGCTGATGCACTCACGATGTCATTTTCTGTTTGCTTCAACGCCAAGACACACCAATCTTCTGGGAATCCCATCAGCATAAGCTC
TTCGACGAATTCGGCTCGGGTCTCCTCTGCGTCGTCGTCATCTTCGTCGTCATTGTCACCATCGTCCAGGCTTCCCTCATCGTCTTCGTCTTCATCATCG
TCATCCTCATCATCGCCATCTTCGTCATCGTCATCATCCTGGGCA