Description :
From Genome Similarity Track
Location :
Scaffold_240:34747- 40336
Transcript NameFunction/comments
Phyta_totarag6059hypothetical protein PHYSODRAFT_262310
Phyta_totarag6060hypothetical protein PHYSODRAFT_511420
Phyta_totarag6061flavodoxin/amb allergen/pectate lyase

Sequence
5589 bases(100 bases per row)
TAGTCAAACTTCTTCATTCACACAAAACGTTGTTCTAAAAACGCACTCCAGATCACCAGCTAAGCCAGAAGTTCATCTAAACTTGACCTTGCATAGGCAT
TTCCATCGATTGCTCCTTCCAGGGTTTACACCTTGGGCCAGCCGCTCGAAAAGTCGAGCTTGTTCCAACCAAAGCGCTTGTCACCGTCCGCGTAGCCGAT
GCGGGTATCCACTGCACCATCACCACAGTCAAGACCACAACATTATTAGCACTCAACCATTTTGAAAGGCTATTCCTAGTCGAAAACAATTGAGAGCGCA
ACTTACCGTAGTGGTAGTACAGCACAGGGCCGTTCTTCGGGTCGTTGTACACACCCTGGCCTCCTGGGCCGTAGACCCAGTCGTGAGACTCGAGCACAAC
GGTGCCACCGTTGTTACGGCATTCTTTACCGTTCTTGTCGACGAAACCCGACGTTGGACTCTTTGACCGGCACGCCAGGATGCGGTACTCCTTGCCCTTG
GCCGGTCGGGTCTTGTCGTAGCCGCAGCAAGAACCCTGGGAAAAGAAGAGGTAGTAGTAGCCGTTGTAGGCAAACTCGAACGCGGCCTCCATGACCTCGT
AATTCGACGTAAACGCCAACTGGTTCGCGACCTCGCCAGTGTTCTTCGTGGGGTTTGACTTCATCTTTGCCTGGTAGAGATCTTGCCAGTAGCTGCCAAA
GTTGAGATAGTATTGGCTGCCGACTTGGAACAGGTTCGGGTCGATGgcgttgtacttcttggaGGAGTCACTCGTGATGCCAACACTGCCAGCATCAGTC
CACGTGCCTGCCTCCATGGTCTTGGATCGGGTGAGGCCAATGGCTGAGTTCTGCGAGCCGAAGGTGCTCACCGAGTAGTACAAATAGTACATGTCACCCA
CCTTGTGGACATCGGGAGCCTAAAAAATTACCGCAAGAGAGATTACCAACAGTTAGGCCGTGTAGGATAACTCCTAAAGTTTTTCACGTATCCATAGGAG
GTACTCACCCAGAGATCATCTTTGCCGGCCAAATTGATCTTGGAGCCGCCCGGTACCGCAGCACCCAAGTACTTCCAAGGACCTGTGAGTGCAGGAGCAG
AGTGGATGGCGATCTTGTTGCCGGTGGAAAAGCGGAAGTACGTGCCGTCGTCGCGGCGAATAATAGACGGGTCGTGGGCGTTGGTGCAGACGCCTGTGCA
CGTTTGAGGGTTGGCGTATCCGTTTACGAGGCCCGCCACGAGGAGGGGAAGCCCAACGAGGATCGAGAGGAGCTTCATAGTTCCGAATTGACAAGCCTTG
GACACCGTTGCGGTCAGATTTGAAAGTGACAAGCTATCCGCTTTGAGCCGAGGGCATAGCGCTCTAGGCTCGAACAGCACAGCAGACCATCAGGTAGTGC
CTCTACCGTGACGTCGTATTTCGACTGTTGCTGCGTATGTCGCGATCAGTTGACCACGTAAATGTACCTGGCAGCTGGATCTGCCGCCGCCGGCTGTGGA
CTTCATTGCGATGGATTTGCTAGAAGTGCCACGTCAAAAAAGAGCTGGTAAACACCGTCGGCATTTTCAGCAAAAAAAACTTCGAAGTAAAAAAAACTAC
GCGAGCAATGAACGTTCAGTGACTTTCCTCACCGAGGATATATCAACCAATCTGGATACCATTATGTGGGGCATTGCAGTAAGAGCATTCGCCACAGTGA
ACTCGCACAATGCTCTCATTTCTGCTGATCTTCACTAACTTCTTGGTCACAATGATTGAAGCGTCAAAAtcctgtacatgtaagacAGAGGTTTACGGGG
GAGGGGCTGTTTCGTGCGAACGctgcgatgcagcagatgtGGCCATATAAACCATGGTGTCACCTCGGGATTTCAAAGCGCGAGGAAACGAGTGGCTCGC
TACTTTCTTCGCGAGACCCAGTTGACGCGCTGACCaccaatacatgtacaggttGCGTACGATCGTTCCTACCGCATCAAACCTATCTTTGGTTGTTAAC
TTAGCACCTTTTTTTTCTGTGCGACGACTTGTCAACGCGTTCCCAGTGTTCGCATGGTAATGATGCGGGAGAATTTGGCGTAAGCGTAAGCTTGCAGTGT
ACCGATAAGCTATGGAAAATGCGTTCTAGGCAAATCGTAGATTCTCGGCAATGAAAGCGAGCGCCCTATTGGCAATGCAAGACACGCCTTCGAGTTCTTG
GCCGATACGACAGAAACACTGCAAAACCAAGCAGAATCCATTGACTAATTTTTTTCTACTTTAACGTGATGTTCTTGCTCTACAAGTTGAGAAGAAACCT
CCTTTCAACTTCTTACACCGTAGGCCAACCACTCGAGAAGTCGAGTTGGTTCCAACCGAATTTCTTGTCTCCATTTGCATATCCGATGCGCGTGTCCACT
GCAAAGCGAAGCAAAACCGGCACAGAAGTCAGCAAAAAGTCAAAAAGAAGATGCTATAGTTCGCCCCGAGCAGATTCGAGCGCAGCTTACCGTAGTGGTA
GTACAGCACGGGGCCGTACTTCGGGTCGTCGTACACACCCTGACCTCCCGGCCCGTACACGTAGCCATGGGATTCGAGCACGACCGTGCCACCGTTGGTT
TTGCAGTCATTGCCACTCTTGTCGACGAAGCCGGAAGTGGCGTGCTTGGAGCGACACACAAGGATGCGGTACTCCTTGCCCTTGGCAGGCCGCGATGTGT
CGTATCCACAGCACGAACccttggagaagaagaggtaGTAGTAGCCGTTGTACGAGAACATGTACGCAGCCTCCACAACCTCGTAGTTCGACGTAAACGC
CATTTGGTacgctgcttggcctccGGTTTTCGTCAAAGTTGACTTCATCTTGACCTGGTAGATGTCCTGCCAGTAACTTCCGAAGTTGAGGAAGTACTGG
GTGCCGACTTGGAACAGGTTCGGGTCGATTGCGTTGTACTTTTTGGACGAATCGCTCGCGACACCGATACTACCGAGATCAGTCCACGAGTCAGCCTCCA
TGGTCTTGGAGCGAGTGAGACCGATAGCGGAGTTCTGTGACCCGAACGAGCTCACCGAGTAGTACAGGTAGTACATATCACCGACCTTGTGAACGTCCGG
GGCCTACAAGGAATGTTCACGAACGATTTAGTAACTGCTTCAAATGGACAGTAAGTCACGGTAGCTCAACACCCACCCAAAAGTCATCTTTGCCCGTCAA
ATTGATCTTCGAACCCCcaggcacagcagcacccagGTAAGTCCACGGACCCGTGAGCGCCGGAGCCGAGTGGATAGCAATTTTATTGCCCGTGGAGAAG
CGGAAGTAAGTGCCATCATCGCGTCGGATGATGGACGGGTCGTGTGCGTTGGTGCAGGTGCCCGTGCACAGCTTTGGGTTGGCATACCCGTTGACAAGAC
TGGCAACGAGCAGTGGAAGAGTGGCGAGGATGGtgaacagcttcatggtTCAAGGAGAATAAGGCGTCCGCGACGGATACGAAGCGAGGGGTTCTTGACG
ATCGAAAAAGTGAAGTGCTAAGTTAGCAGCTAACCGAGCGGCCTGTAAAGGACTGGAAGGGATTGAACTGTGCCTCCACAACAATGTGCTGTCATTGCTG
GCGATCACGTCTTCTTGACGTGCATTAGTATGGGACAGTTCGAGGTCAAATCGACGACAAATGGATCCACCCACCACCAATGGAGTGCGACTAGCAACAT
GTTTGAAGCGTTTTTCTGTACGATCAACGCTTATGTTGAACCTGATGGTCGCacggatgaagaggatgaagaggcGAGATTCGACGCACGACCACCATTT
TGCCAGGAGAGATCGGTGCGAGTTTTTTTGTGCCAAGACGAATGCATTTTCCGATACCCTTTGCAATATACTTTGAACGACATGACTCTTATTGACTTTT
TTAGTGCACGATGCAGTAAAAGCCGTCTGAAAACAAACACATCTAGTGATTTTGTGCGGTGCTTCCCTCttcttacatgtacagcatcAGCTCAGTTGAG
CACGCCAATGCCAAAGTTCTGGGTCGTCTTGCTCCACTGCACGGCCGAGCGCGGGCTGTAGCCGGACATGGCCGAGTACGACTTCACCTTCGACAGGGCC
GTCGCACCGTTGCGAGAGCTGAACGAGCCGCTGCTTGTCACAACGTTGGCGGCGCAAGAGCGACCCAGGTAGCTGTTGCActcggtggtggcggtggcag
cgtACATGGCGCCATCCGAGCCAGTCAGCAGTGGCATCGTGGTGTCCTTGAAGTAGTTGCCCTCAGCGAGGATCCACGAGTTGACGCCGACCTCGAACGA
GTGACCCGAGTTGTCCGCCCAGTAGTTGTTGGCGATGTGGGCGACGACGTTGGCACTGCTGTCACCTCCGATCTTGGGGGAACGGCCAGACGTGGAGTGG
ATGTAGTTGTTGAGCATGCTGAAGCGCGTGTTCTTGCCGTAGAAGATGAAGGACCAATAGTGGCGGCCATCACACGACGCGGAGTAGTCCGTGCGACCGT
CAAAGTCCGAGTTGCTGATGGTCACCGTGGCCTCACTGGCGGCGTTCGTCGTCAGGAACTGACGGCCGACGCGGGACACCTTGACGTGGTCTAGCCAGAT
CTTGTTCATGGCCGTCGAGCCGCCGTTGCTGCCCTGCATGTAGAATGCGTCTCCACCCCAAACCAAGTGGCGGTTCAGCTCCGTGATGTGGACGTTCTGG
ATGATGATGTTGTCTCCGTTCAGCCACAGACCCTTGCCCATGATCACACCGGTCGTACCAATGCCGCGGAGGGTCTTGTTGCTAGTGACCGTCATCGGGG
TGATGGCGGCCTTGTCGTACGTGACCGTCACGCTGGTGCCGTCCGAGCAGCCGCCCGTGTTGGACATGCCGCCGCTTTGCAGGATCACATCCTGGCTCTT
GTAGCCGTTGTTCTTGGCGATACACTCGCGGGTGTAGTCCGGGCGGCAGCCAGCCTCCGTCGTGGTGCCTTCGGTACCACGGAAGTCGaatgtcttgttc
agcacAATCACACGTGGCACGGCGTCCTTGAGGTACGCAACGAGCTGGGCTGTCGTGGTAGGGTATACAGCCgtggcgctgccgccgcccGTCGTGCCGG
TAGCGAGACCGGTAGCCGAACCGACCGTGAACGCTTCGGTAGTCTGGAACACGAGGGCCACCACCGCGATGAGAAGAGGACGGAAAAACTTCATTGTCGG
GAACGTGCGGGTGTTTGGAGGTTCTTGCAGCAGGCGGGGCAAATTGTTGAATGGAGCTTCGCATGATCCAGCGATGGCAGCCTGCCTGCGGAGGCCAGCC
CCGCTGCCGACGAGGGTCGTCTCTCTGTCTTGCTGTTAGAGAGGGCGAGTCAGTGTGCCAACATAAGGAGTTGAAGTGATCGTTCCGGCACGAGAAGCTT
GCTTGACTCGGTTGCACACGCCCATCGTGCATCGTGCATCTGTTGAGCTCTACCGATCCTTCTGGCGCGACTAGCAATACGTTAGACGGGTCAACTTCAC
CAGCTGCAGAGTACAACAGGGCGAAATGGAGAGGCCTAGCAACAACCAACGTGGCTTGATTGATTCTTGATTGAAGAGCGAACGCGAAA