Description :
From Genome Similarity Track
Location :
Scaffold_110:34741- 42373
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_110-snap-gene-0.19Calmodulin-binding WW domain protein
Pytul_var.sporangiiferummaker-pug3_contig_110-fgenesh-gene-0.860S ribosomal protein L35
Pytul_var.sporangiiferummaker-pug3_contig_110-fgenesh-gene-0.14DNA repair protein RAD51 homolog 2
Pytul_var.sporangiiferummaker-pug3_contig_110-snap-gene-0.21YneE

Sequence
7632 bases(100 bases per row)
ATAAAACTCGCGCAAGTGGTCAGTACGGCAGCACGCAAAGCGCGTCTTTTGTACTTGCAGACGATCGAGTTCCACGATATCGTGCGGTATGCGTGGGTCG
TGGAATACAACAAACACGAAAAGAAAGAGGAGTTTTGGAACGTCGTGTTGAACAAGCGAACGTTTGAAGTCCCAAGAGCCATGGAGCTCATTGAGCAGAT
GGAGATCGAGCAGCGGCAAGAAGTGGAGCAGCGCGTCGCGATTGCGAAAAGCAAACTGCTCGATTTGCTGCATCCGTTCCACTCGAAAAACAAGACGAAA
CTCGCCGTACGCCGCGCTGCTGTCGTGTTTACGACAACGAAGAGAGGTCTTCCGTTTAAGGGGGCACCGAAATCCGTCAACGACAAGGAGGGAAGTAACG
CAGCTGATAACAAACCAACACTTGAAGACGAAGCGGACGCCTTGGTGTGTGCTCGATTTTGGCACGAACGAATCATGCTGCATGACCAATTTGGCGGCAA
AAAGGCCGCAAAATTCGCCGCTGCATGCTCGATAGCTCCTCATTCGACACGGGAGTGTTGGCTCATTGTACGCACGTGGCAATGGATAGATCTGTATGAA
CCAGATGGATACGAAGCGCATGCGAAAACGTTTCTGAACCTGGCAAACGATATCCAACTTTATATTGCCGGCGAGCTGGCACCGTTGCTGGCAAGTGATC
AGTACAAGGACGCGGCAAACAAGTTGCAGCAGCTCCTGAAATTGAAGGAAGAAACGCTTCAATTACTTGTATTCAACGCGTCCCAACAGCAAAACGAGGC
TATTGCGCAAACATAAACAAGAACAATCAAAGACTAGTAGCAGTGGCGGTCGACGTCATTCACTGACAAGCCCAACGGATCCCCCAACTGCACACACGCT
AGTTGATTTTGTGATATCCGTCCAGCTGGGGCTGTTGTTGATCTTTCGTTCGCTTAATGGCTGCCAGAAGAGAGTTTCGTCCAGAAGTGTCGCCAGCCGC
ATCGTCGTCGTCGTACTCCCGCAACTCTTCACTTGGAAGAAGCCCCTCCTCCAATGAATCCATCGTGTCAATAGATGCCACAGTCGAGTCAGCCAAGAGC
CGCATGAATTCGGCTTCATCCTCGGCATCCGAAGCGGACGCATTGGCCTTGGGCTTTCTCTGGAAAAAGCGAAGATGTGGATGATACTGCACAGCGAAAA
TGGCAGCCAGCGCCACGACGCCCACGACAACAAACGCGATGAAGAAATGAGCTACGAAACAAGTTGATGCACAGAACGAATTGTGTGAGTGTCAACCATT
CTTCTGTTTCCAGTCTTGAGGGTTCACAATGTAAGCAAACACCACTTACATTGATAAAATGGAGACACTGTGATGAATGCAACATGCAACAAATAACATC
AGCATGAAAGTCGAATGTGAACCAACAATACACAAAACGTTTGCAAGAATGCCACGTACCTGCGACAGACAGCTGTTGAGGTGCGTACGCAAGCATCGCA
GGGTGTCGATGGTTTGTGGATCTCGGCAAAGATGCCATCAGCACAAAGCGATACTCGCCGCTGGACTTGAACTGGTCGGCAAAGAGATCGTCCAAATTCG
CGTGCTTGTCGGTCGAGGCCCCAAGCAGAGTGTTCGTGAAACTCTTCGTCGGCACCTGGTACTGGACGCTCGAGCGCCGCTGAATGCAATAAGGAAGCGT
GTCTTGCTTGCTGACCGTCGCATTAGGCTCAAGTTTCTCTGCAAACAGAAAGTACTCGCACGCTTCGCAGACCTGTTCTTTTGAGAGACTCGATGGTTCT
GCTGGATGTTCCCATATCGATGGGGAGGCGAACCCGAGCGTTGTCTTCCTGTACGAGAAGCTCACATTGAATGGCGTCGGTGTTAAATCATCTTCCGCGT
CAGTGTTGACGAGAAAGGCCTTTTCAAAGCCGCCAGAGGACTTTGTCGACCGAAGTAGGGCGATACTCTCCACGGGCTCACCGATGTCTGCGCGAAGGAT
GAAGCCGTCGATCTCGAATGGATCGTAGTGCAGCGCGACCGGGTGAGACGGGTCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA
CGCTTTGCTGCTGTTCTTCATTTGCGTTGCTGATTGTCATGCACTGGTAGCTCGCGGTGGAAAAACGCTTTGTGCGCTTGCTCTTGAACTGGATAAACGA
TTGGAGCTTGCCGCGGCAGTTGCTGAGCTCCAGGCCAAGTGCAAAGCGCGATACAGCAGCAGCTGCAGCGACAGGGTCTTGGTTCAATGCCTCAGTAGAG
GGATACAACAGATCACGGATCGGATCCAGAGGCAGTAGCACGGATTCGCCGCTTTTCACGTGAATCGTGAACGGCTTGTCAGGGCTGAAGTGGCTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTCGTAGGTGAACACATGGTCGACCGCAGGCGCGTCCACGTGCGAGCTGGTCTGAACAGATTCACGAGTTTCCTCAGC
ACTTAGGGAAGGTACAAGCGTTGTCTGCACAGGCGTTTGGACCTTATCATGTTGGTTCTCTCGACCTTCAGCAGCTACGAAAGATACCGCGGCCTCGTCC
TGGAAGAAGTGGTACACGCTGCCTGGCGTCGCGGACGCATCCGCACGAGATGTCATCGCTCACACACTCGCGCACACTGGCAATGAGATCGAGGAACGAT
ACGCTTCGACGGAGCCAACGCTGTCGTTGCTCCTGCTCGTCGTAGTCGTGCTTGAAGCAGGGGGAGATTAACGAATACACCGACCGATTGCACACCCAAA
TAATCAGGAACGTTTGCAGAGTGATGGTAAGTACGTAAGAGGGATCTGTTTTTTTCCATTTTTAGCCAATCTGATTGAATGACCCATTGTCCCACTTGCT
GCAGCAGCCTCCTTCTCAACGTGAATGGGTGAAAAACGTTGCTGCAAACCTGGCTAGAACCAAATCGATAAACAGCAGGTGCACATTTACACACCATAGC
GATGCGTCTAGCGCACCATGTAGAACGCAGTTGGGTCTTTGTTCGTTTTCTTTGTACCTGGTCTTTTGCTGTTTTCCAACAGCGTTTGCCCCACTTTGGT
GTGGTGCCAGGATGATCCATGTCACTCGCGTGAGGATTTAACTGCTGTTTAATGTTGCGCGAAAGTTGTGTGTACCAAATGGCCCTACCCCTTTCCGCTT
TCCTATCAAATCCCAAATCGATTGGTCAGGAGCGCGCTTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGACAGGGGATTTACTGT
TTGTCTCTACTGCCATTACGCGCTTTTTTAAGCGGCGCTTAAATGTGTCGGTGGCGAAAAGTGAAGCTCTGGGCCGAGGTGACGCGAAGGTCGCTCGAGT
TGGCGAGGGCGTGATGTCCAGCCAACCAGTCTTTCCGAGCTCTTTTTGTCGCGCGAATTACCAAACGGGAAGTTAGAAGCTAACCAACGCCAAGTAGGAA
AGAGAATCATGGGTAAGCGACTATGGCCGATATGAATGCATGGATGCGTGCGAGTAGCGTCTGCTTCAGGGGACGTCGTGCTGCATGCGGACAGTGACAG
GGGGAGGCGGAACCAGACCAACAGGCAGAACACGCGTGATCCATTCCAACAGCGCAGCATGACTTGGGTCAAAGCAGCCATTGAATGCGACCAGACCAGA
GCGAATTGGTGATGACAGCCTTGGAGAGCGATTGGAATTTATTTTCAATGAGCGCGTCTCGACAGACCCTACGCCGCAGTATTCGATGACATTGTGCGAT
TGTCGTTGTGCTCAGCAACGATTCTTGAAGCAGCAGCGCAGCGGGAGTTCTAGGAGCAGTTCGTCAGCCATTCGTTCGAGTTTGCCTGCAGAATGGAATG
GATCGAGTCTTCTGCCTGTTTGGGACTAGTGTATTAGTCTACTACCCGCTGCACGACACCCCCGCGGAAGCAGATAATCTATCTTTGCCGGGCATGAACC
ATGACTCACGTGCTGTGTTTGCTGTGTGAAAATGCGATGCAGTCCAACAACTTAAGGCTCACGAACTTCGTACTTTGAAGAAGTCGGAACTCCTCCGCCA
GTTGGATGACTACCAACAGGAATTGGCTCAAGTACGATATCAAGCAGTTACCTTTGTCACGATGGAATAGGATCTTCTAACATTGCTGTCTGTGCTGCTT
GTATCAACAGCTTCGTGTTGCCAAGGTCATCGGTGGTGCCGCCTCGAAGCTCGCCAAGATCAACGTCGTCCGCAAGGCGATCGCTCGTACCTTGACTGTG
TACAACCAGACCCAAAAGGCCAAGCTTCGTGCCGCCCTTGGCTCGAAGAAGCACGTGCCACTTGACCTTCGTCGCAAGAAGACCCGCGCTATCCGTCGCC
AGCTTTCGACCCACGAGAAGAGCCTCAAGACCTTGAAGCAGCAGAAGAAGGAAGCCTACTTCCCAAAGCGTCGTTTCGCCCTCAAGGCGTAAGTTAGTGG
ATTTTGTGAATTCAATTCGCATGAATAAATGATACACTCCAGCTTCCCACTATTTCATCACATCGAGTGTTGGCTTTGTCTGGATCATTGTGCATGAGTC
TTCATGCATCATGAATTACCCCTTATCCAAAGCATGATAGTTATGTCACCTTCAACAATATAGTCTTCTGCTATCGGTCTTCTGTGAGATCCCCAATGGA
CTTGTCGTACGCATCATCTTCATCATTGGAGTCCGAGACGAGATCAAACAGATCGAAGCTGCTCTCGTCTGAATTTTCGCCATCGTTTTCCTCCCTCGCG
GAAGATTTCTGGGTGGACCGAAGCGTGCACGATGGTTCCACCATCGGCAAACTTGCGAGGTTGTAGAGCAGATCATCATGAACATCAAAGTTGTCAGTCT
CAACGGTTGAGAGTGTTGCCTCATCCACCAAAGCCTCCACACCGGATTCCTAAGCATTGGATCGAGAATAAAAGCAAAAACGAGTTAGAATCCTGAAGTC
AAACTATGGAATTGGGGCAACTGTTTCGACGAATGAAAAGTCTTCAAATTAATACAACCGGACGTACATCAATTGCGTAAGGTTGGATAACATAGCCAGC
AACAGGAGACTTGACGACTGCCATGATGCGATGCTGAGGATATCGTTCTAATACAACCTACAGCATAACAAATTGTCAACGTTTATGCTTTCTATACCTT
TAACGGCAAGCAATCTGACCCTGGTGGTGGCGCAATGGGCCCACGTCTCGCCAAGATGAGCTCGAGTATACAATCCTGCAGCACCCCCAGCTGTCGAAGC
GCGATTCGTGACCACGACAAATGCGTGATGAGTATCGGCAAGCAACCTAAATTCCAGTCGTACCGCGTCAGTTAGACTTGAAGTGTAATACATATCTCAA
GTAAAAATTCGGCGCGACTCACTTGAGATCTCGTGTCAACTTCAGCATCTGATGCTGGCGCTGTGCTGGTGTCTGATCGTTCGACTAGTTAATAGCGAGT
GCACACAAGTAAGTATGATGCAGGGACAATAGTATACAAACCCATTGTACTTGAATGAAGAGAAATTTACCTTCATGAACAAGCTGGCTACAGAGTCGAT
CACAAGCAGCTTTACGTTCATCGCGTGCATGCTCTCTTCAAGCTCTTTTAGCCTGGAATTAACGCAAAGAGAATAACGCATGAGTCAATACAACAAGCTC
AATGTGCTGCAGTGAACTCCTTGATCCTTTTGACGTACTTGTGAATAAACTTGCCCAGAGAGTCAATTTTCACCAAGCGGATCCGTTTTACGATTTCCTG
TGCCATCAGTTCCACGTTGGCATCCGGATGCACGTTTCGAAGGCGCACTCGAGCCGTGGCAATCTCAAATATTCTGCATTGAGTGGATTCCACACAAGGT
TGAATTCGTTGTCACAGAAGCAATCCATCTAAAGTGCTCACGTTGCCCTTTTAAGCATCGATGATACATACCGCTTTGCGCTAAAGTTGTGCTCCGTGTC
AAAGTACAAGATCGTCGCGGCGGGGTACTCGATCGCACACAGCACACTAAGCGTCATCGCAAGCTGACTTTTACCGATTCCTGCTATTCCAGCAAACTAC
ATATCGAGAATGTCACGACTCACACACGCTCGCAATATCTTTCAAGGTAAGGGGAGACACTAAAGTATACCTCTGTGATTCCGCCATAGTTGATACCGCC
ATTGAGCGCTTGGTCCAACGCTGGCAAGCCCGTGCGAAGAAACACCGGGTGGTTCGCGCTCTCAATGAACATCTCAAACGCCTTCCTACCAGCAAATTAC
ACATACACTTAGCTACAGCCCATTTGACATGAAGACATTAACACTCAATCGTACTGTTCGACTGGGTGGAGCTAGCCGCGTCGAGATCCGTGCAAACAAG
TCCTAGTGGTGTAAGCAACAAACAAACCCATGGCGCATCAGCTGAGCATAACAAAACCAGCATTGCACAAATGTGCATACGCACCTCCATCTCCTGCACA
GAGACATCCACTGCCTGCGCGAGGTCCCAACTAGAGCGCATGGCAAGCTGCTTGTAGTGCCGGATGCCCGCCGCATGAAACAACTGCTGCTGGCGCTCGG
CCACGCTCTCCTTCGCCAGTGCGCGCTGCAGCATCTCCCTCCGCCTTCGTCTTGATCTTGATGTCAACAAGGTGAAAGTTGCAGTTTGTGGTATCTAATC
GACTCGTTCAAGTACGATATATAAGCCCACTGAATAGAATAGGTTAATTATTATGATTTTACGCAGGTTTGATGAAGTTTTCTCTCCTGAAAGGGCACAA
GATGGAACGGTGGTGGACAATCGCGCGCCAATGAATATGGGCGTGCATGTGTGGAATTTTGCACAACTAGAGAGACAAATGCTTTCGGATTTCCATGTCG
ATCTACATGTCTGCACAACGTTCGCTCAACGCATTCGTCTTCCCAGTCATCGGCAGGGAATCGGGGTTTGCCCAATCATCAATCCCGATACTTTGTGGAT
AAACGTTGACGGTTACTCGATGCATAATAGCACAATGGAAAAAAGGAGACGGTTTTTTAGAGTTGATAGTAGAAACAGCAGGCGAGTCACCTGGCGATGC
AGCTGCGCTCGTAAAGCGGCATATTGCGCTCGTGCATGATTCTTTCGGTATTGGGGACTTTGGTTGTTGTGGCCGTTTCAGCTGCGCGTTGCGCTCTTCC
ACGCTCGCTCTCCTCTCCCCTCAATTCACTTGAGCCTGTGGTGGTTTCTCGCTCTTATTTACCGATTGACCGACCTTGACAAGCACAAACGAACGACAAT
GATCTACTACGAGACGGATCAGATCCGCGACGTGATCTTCCGGTGGCACGGCTCGGCGCTGAATGGACCAGCTCCAGTGCGCGCCGTGTTCATGGCGCTC
TTTGCACTCTGCGTCGCGGCTGTGAACGATTTCCACCCGTTTNNNNNNNNNNNNNNNNNNNNTCGTGCCGACACGCGAAAGCACGGCGTTTGTCGACACA
CTCACGGTATTCAACACGTTCCTGGGTCTCACCATCTCGTTCCGTTTGAACTCGGCGTTCCAGCAATGGCGAAGCGGCGTCGTCACGGTCGGGTCGCTAA
CGGAAGCCGCGCGTGGTATTGTTGCCTCCGGG