Description :
From Genome Similarity Track
Location :
Scaffold_1200:3474- 5832
Sequence
2358 bases(100 bases per row)
GTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGAAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAA
GGTCCGATGAAGCGGTGCTTCAGTTTGTTGCTGCCGACAGAGCTAACAGTGTCTAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCACCAACCTCAA
ATATACTTAAGTTTCCTCTTCCTTGTTTGTCTGAGTACTTCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTT
GGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGATCCTCTCCCCCACTTAGAATA
GAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGT
TGAGCGCAAACTCAACAGCTGGGAGCTGCGTCGACCACGTACGTGGAGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGGTTGACGCGCTC
TGTTTGGCCTTCGGTCTGCGGATGGTCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCCGTGAACCGCGGG
TCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTTACAGTGACGGGAACTG
GAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCAT
CGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCGGGCGGGAAGCCCAAAGATGAAAGTCAAGACTCATCGACTTCAACAATCAGCCGGTACGGCAGGCTCTGTAGTGGAGCCGAAAGAGTCCCCTGCGGG
TTTGACCCGCTGACATGTTTCACATGTCTTGACGTACCGGGCGACCCACATGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTC
TCGCGGCCCAAGTGGCCGCTGGAAGGCGATTCATCCGCCTCCGCGAGGATGTCGAGCTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAG
TGGGCTCCACTCGATAATAGAGGAGGCCCTCCTTCAACTCATATCGGCGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTCCC
GGCCTTAAGGAACTTGACGATAGGCGCGACAGCCGTATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCC
AACTCATAGTCGGGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTACTCCGCGAAGAAGGACAGCC
ACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACGAAGGGCCTAGAGCCCAGAAGGTGAAC
ACGAAACTTCACAAGGGCATATTTCATTGCCAGAAGCTCCTTGTCGTGGACAGGGTAGTTCCGTTCGGCGGCTTTGAGCTGCCTGGACTGGAACGAGATG
ACTCGTTCGTGTCCAGCCGTGTCGGCCTGCAGCAATGCACACCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCA
GGGTCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTTAAGGAGACT
GTACTTGTGGAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTTTGGGATCGGGGCGTTGGCCATGCTGCTATGGCTTTGACCTTGTCTGGTCAG
CCCGAACGCCCACGTTGCTTACGAAGCAGCCGAGAGCTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCAT
TACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGCAGTACGTCTGTA
CGAAGGTACAGACAAAGGGCGGAACAATTGCGTCACCAGGCGACTGAGCGTCGCCGGG