Description :
From Genome Similarity Track
Location :
Scaffold_30:347393- 352712
Transcript NameFunction/comments
Physo_134185hypothetical protein
Physo_134186reverse transcriptase

Sequence
5319 bases(100 bases per row)
GCGTACACACAATTAGCAGCTCTCGCGGAGTGCGGGGGGGGCGGATCCACGGCTTACATCGCAACTTGCCTGGTCTCACGTCGATAAGGCTATCGTATCT
CGCAGCTGCGGAGTCATGTATCTCGCCGACGACTGCTTCCACTCGAGCATCACGTGCCAACCTGACAGCCTCAGGCCAAAGCTCGTGGCGAAGCTGTTGA
ACGTGAAGCCCAGTCCGCGCGTGGGGACCCCTACGCAGTACGTGCTGCAGTGCACACTCGACAGGACGGACTTGGAGTGGACCGTGGAGCGCCGGTACTC
GGATTTTCGCGAGCTGAGGAAGGTACTGCACGCGTTCTTCTTGCGCCGCGGCGGGGGTGCCCGTCCGCAGTGCTTTGGGTGTGCTTGGTTCGCCCAAACG
CTGCGCGGGTACTGGTTCCCACGACGACACCTCCTGTGCTCGCGCTCGCCCGACGTGGTCAACCAGCGCCGCGTTGGACTCCACCAGTTCGTGCTGATAC
TAGCGTCGCACACGTTCTCAGCGGTGCCCAAGTGTACCTCCTGCGCCGACGCCATCTTCCCGATCGTGCGCGACTTCTTCTTGCGGGGCGCTATCCTTCC
CGACAATCTAAGCTTGAAAACCCTGCAGCGAGCACTGCAGCCCAGCAACTTTTCGCCAGTGTCCGATCCGAGCAAGAGCAAGATCGAGTTTCGCAAAAAG
CGCTCCGTCTGGAAGGTGCTGCAGATGGAGAAGCCCGTGTTCTCCAAGCTCAGCGAGTACAAACAGCAGCAGACGAAGGGGCGAAGGCGGCAACGGGCTA
TTAGGCCGTGCTCACCACTAGAAGACGGCTGGAGAGTAGCTTTGGAGGCCTCCTCCAGCGATAGTGTCGTCAGCTGTGAAGCCTAACGACGCGAAATATA
ACTTATTGAGCCCACAACCATCTGTAGCCATGCATGAACGAACACTTCAACTTCAGTTTTGTGTTAGTAACGGGTATTGTCCAAAAACGCCCTCCGATTT
GAGGTCCTACGTAGGACTTTTGCTCCTACGTAAGGTCTCATAAAAGTTAGTACCGAGGGCAGTAAAACCCGGTATAAACAAAAACTGAAAGTAAACTGAG
CGAATGACTTGCAAAGGTAGGCTGCAAGTCAGCGCGTTCAGTACCGTTATACCTGTAGCACATGTACGTAGCTCCACGCTGAGCACGGTGACCTGGGTGC
GGTGCTGCCTGAGTCTCCGCCTGTACGAGTGTGGCCAAACTATGCACTTGCCACAGATGCTTTCAGGCGCACTGGCCTGATCCAGTCCTACGAAGGACTC
GTTAGCCCTACGAAGGTCCAAATGGCCAGCTTAACTTGGCCATTTAGGTGAAGACGGAGCTCCTACGTAGGACTTTCGTAATCCGATGCAAGGCCAACAG
CAAATCCTAGGTTGAGCCCTACCCCCTCCTTCTTAAGACCACCTTTTCGAGGTCAGATTGGCCAAAGTTTTGGAAAGCACTAGTCACAACCAGGCATGTC
CGGAGGGGACATTTTGCAAATCATGCCCCCTTTTAGATAATATCTAATAGATCTACGGGGGTGGGGAATCCCCACTGGGGATTTTCAAAGGGGTGGCCCG
ATCAGTAATGTATCGCTGTGTATTGAAATCTAAAACGGGGCGGTACAAGAATGCATAATAATGTATAAGAATGTAAACGTGGTGGCCTACGCTAGAGTGC
TTGGTTTGAAGAGCAACGCGCACTAGGCAGCTGCTTGGTACCTGGACATCTTGTCCGCCAAACGCATGAGCTTAAAGTATTGTCGACATTGCAACTCACC
TTCCATCGCGTAGTTGCTGAGTGCGGACCCATCGTACGCGTCAGCGTGCTGAAGTCACCCTCTACTGTGTGGATTCCTGGCGCAATACTAGCGAGACCGA
CACAACCTCGGCCAGCAGCTTAAAGTTGCCAAACGAGGCCGCCTACTCTCAGACAATCTCGAGTGTCACTTCACGCGCCGAGTTTCGTTGGCTTTCAAGC
CGGGGCGACATTCAGACTTCTTGCTGAAGCAGTGCAGCAGTTGTTAGGTTTGGTTTCAGATATCGGTTGTTGCCGTGGCGCCGAATCGAGCCTTCAACTT
AAGACTGAGCCGCTAGCAGACGCGTGATCCGTGTACTATATTATATCGATAGGAGAAGTAGGAGGTTCCTCGCGGCAATTTTTGTTGATGTCGAGCTGAT
ACACGACACGGTTCCGATGAAAACGGCGATGGCCTCAGCTACCGCTCCAACGAGTTCAGTCTGAGTCATTGGATGTTGGGGTATGGCGGGATCTATATCG
TAGTCGGCGTCGTTTTGATCCGACTGCTCGTCTGGAAAGGGCTCTTCGTCTGAAAATTTTCCAGTGGGAAAGCGTCTTCCAGCTCGGCGACGTCCGTCCC
AGCGCGGATCTGGGCTTCTGTGGCGGTCTCATGTCTTTTGTCTCCGACGGCCATGCAGCTAAATAGCGCCAACGACTTCAATGAGCACAACTTAAGGTGG
TTGGCCGCTTTGATCTTTTCCACATTCGTAGAGCTGTCTTCCGTGCTCCTCTCGTGTTAAGACTGCAGCAATCGCACAAACTTATCCAGACTGAGTATTG
TAGTTGCGAACCTTGCTTCGCGCTGTGTGCGCTGATTCGAATAGCTTAGGGAAACCCAATATACATGTACATGTAGTAGGAAGCCATGCCCATTTCAGGG
TCTAATCTGAAGTAGGTCAATGTTATGAGCGATGCTAGTGACACCATGCACCATGCTGGTGGTCTATTTGCTACTATAGTCGCTTATATACATGTCCTGT
AGTCCTAACACACGCTACCAGGTCAAAAATCGGATGTAAAGTACAATCTATTCCCTTCATCATCAGGATTTCCTTAGTTAAGAGGGGGGGCACTCTTGGC
AACTTTAAAAGGGGTATTTCGTTATTTTCCTGTCAACAGCACCCCCTCACGAGTCACAACCTTACCCATTTTTGGTTTCATATAAACTAGCCGAGCGCCG
CCGCTACGCGGCGGTGATTTTTTAGTTTGTTGGCGCTTCGCTCGCTATGCTCGCTCCGCTATTGGAGCAGACTGCCTACGCTTCGCTACGGCAGTGGCGG
ACCCGTTCCGCTCGCCTCATCGGCTCGCTGCACTACTCTCAATGTCAGGTTAGTAATACAGAGGCCGGGGTGGGTCCTGCGGGGGGGGGGGGTCGCTAAG
GAGGGCCCTCGTTACAACCAGGGCATTTGGGTAAACAGATGACAGTAGGTAACGCTTTGAAATGGGCAACTAGAAAACCCAAAACCAGTGACCCGCATTA
GCTCGAGAGGGTCACAGGCGACGGCACGCTAGAGCTGAAGACGCTGCAGACACTGCTACATTAAGCCCAAAGCAGCAACTCAAGCAATCACAGGGAAACA
TGTCATGGCAACCACAGAGGAGACCTCGGAGGAGCCTTCGGGGGGGGGGGGGCCTTCGGAGGGGACCTCGGAGGACACCGTGGAGTAGACAGCGGAGGCG
GCCACGGAGAAGACTACGGAGAAGACCATGTAGTAAATGTTGGAAAAGGTAAGGCGCCGCGGGGATTGAACTCACAACATACCTGTAGAACACAGCTCGT
TAGACCGTTACACCATACAGGCGCCCCGGTCGTCGTCTCTTCGGGCTGGGACTTGACACTGTCTGATTGCATATTCCAACCCCCCCCCCTCAATCGAGAG
TGTCAGGACCTCCTGATTGCGACCTTTCCTGCAGCTTGTTGGTCCGACTCCAACGCCTTTGCTGCAATGACCTCCCTGGGTTTAAGGCCACCCGTGTCTC
CCCCTGGAGACACATTCCGTTCACAGACACCTCGTGTTATGACACGAACCACACAACCATCACTACGGTCCACATTCCAGCAACCTTCACCTGACTAGTG
CCACAGTCGACCCTTCGACCGTAACAAGTGCTACCATGTTGGAAAAGGTAGGGCGCCGCGGGGATTGAACTCACGACATACCTGTAGAACACAGCTCGTT
AGACCGTTACACCATACAGGCGCCCCGGTCGTCGTCTCTTCGGGCTGGGACTTGACACTGTCTGATTGCATATTCCAACACCCCCCCTCAATCGAGAGTG
TCAGGACCTCCTGATTGCGACCTTTCCTGCAGCTTGTTGGTCCGACTCCAACGCCTTTGCTGCAATGACCTCCCTGGGTTTAAGGCCACCCGTGTCTCCC
CCTGGAGACACATTCCGTTCACAGACACCTCGTGTTATGACACGAACCACACAACCATCACTACGGTCCACATTCCAGCAACCTTCACCTGACTAGTGCC
ACAGTCGACCCTTCGACCGTAACAAGTGCTACCATGTTGGAAAAGGTAGGGCGCCGCGGGGATTGAACTCACGACATACCTGTAGAACACAGCTCGTTAG
ACCGTTACACCATACAGGCGTCCCGGTCGTCGTCTCTTTGGGCTGGGACTTGACACTGTCTGATTGCATATTCCAACAGTAAACGGCGGAGAAGATAGCG
AAGGCGGCCATGGAGGAGACCCCGGAGGAGACCACGGAGAAGACCACGGAGTATACAGCGGAGGAGACGGCGGAGCAGACCTCGAAGAAGACCGTAGAGT
ACACAGCGGAAACGAGGGTGTGGACCGGCGTCTGGAGGATCATGCCGAGAGCCGTGGAGTAGAGCCCTGCCGTGGCAACGGCCCTCTCGACTACGCATAG
GAGTTACTGCTGAGGAATGGGCCCTTGAAATAGCGTTTGTGATCCTCGTAGGCAAGACTTATCTGCTCATATCCTTTTTGAGCACCCCCAACGCACACAA
ATTCAGTTTTATTCTACCTTTCTATCATTGGTATAAGGTTCCATTGGACGCCTACCAAAAACGAACAAATCACCCAACATATTTAAATTTAAGAAAACTT
ATATTTACTCAGACAATTACTCGTTCAGCTCGCTTCCAGCAGTAGGCCCTGCCTCTGCGTTGGTCTTCGTGGTGTCTGTGCCCTGCGCAGACACGCTCTT
CTTCTCCTTGTTCTTGTTGGTATCTGTGCCCCGCACAGACACGTTCTTTGGCGCTTGTCGGCGTCTGTGCCCTGCCCAGACGCGCGGTTCTTGGCTTTAC
TTCGTGTCGTTGCGGCTGACACTGTGCAAGTGTCAGCGGCATTCTGCGGCTGCTGCGTTGCAGTCGGAGATCCTCCCCCACCTAAGGAAGAAGCCATCAT
CCCGAGTAGACTCGGGAGACGTGGGTGCCTCACGTAGAACGGTGTATGTCCAGTCGAGGCATGCACCGAGTTGTTGATGGCGAACTTCACCATCGGCAGG
CACTCGCTTCAGTGTTGGA