Description :
From Genome Similarity Track
Location :
Scaffold_1245:3473- 4653
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1245-fgenesh-gene-0.1Chloride Channel (ClC) Family

Sequence
1180 bases(100 bases per row)
GGATGAGGCTCTCGAGTCGCCGCGCATCACGGAGGAAGAGGCCATCGGTCGCGTCGGCACCGGATCCGGAGGTGACTGGCGCTGGGTCACGACGCCCGAG
AAGCAGCACCAGCAGCAACGAAGACGTGATAACAGCGACGATGCCGCCTCCACACCGCGCATCTCGTCGTTCGACATGGGGCTGCCGCGCCTGCGCCGCT
CTATGTCGCCGAGACCGCGCGCCGAAAGCGTCATGGAGAAGATCATGAATCCGCACTTGGACCGTGATGCAATTGAAGACGCGACTGCTAACAGCAACAG
CGCGAACGAGCGAGCGGATGCTGTCAACGCGAACAGCTACGTCAAGGCGTCTGCTTTTGACGACGAGACCCACTCGGTGTACGTGGCCAGGTACCCGGGC
GGGCTGCGCGGTCTCTTCGTGCTCTTCCAGAGTCCGATCCTGCTGTTCGCGATCGGATTGTTCTCGGCTGCAGTAGGGCTCTTCATCGACTTTTGGCTCG
TAAAGATCGCCATCTACCACAACGTGCTCAGCGACTGGGGCTTCTGCTACTTCCTCGTGTCGTCACTGATCGCCGCCAGCTTCGCGACCATGCTCGTGCA
CTTTGTGTGTCCGCAGGCCGCCGGCTCGGGGCTGCCGTTCATGAAAGTGGCGATCTCCGGCATTGACATGAGCGAGTACCTGTCGTTCCGCTGCGTCGTG
ACCAAGATCGTGGGGCTGCTCGCGGGCTTTGCGGCGGGGCTGTCGATCGGCAAAGAAGGGCCGTTCATCATGATCTCTTGCGGCTTCGCTAGCATCCTCA
TGAATCTGCCGCTCTTCCAGCGCATCAACAACGACGAGACGAAGCGCCTCGAGATGCTCGCGTGCGCGTGCGCCGCCGGTGTGGCCGCGACGTTCGGCTC
GCCCTTTGGCGGGGTCCTCTTTGGCGTCGAGGTGACGTCGCACTTCTACATGGTGCGCACTTTGCCGCGGTCGTTCTTCGCCGCGATCGTCGGCGCGCTG
CTCGTGAACTTTGTGACGGAGAACGCACGCTACGGGCTCTTTGGGAGCTCGGGCCTCGGGATCGGCGACGTGAGCGACCTGCACTCGTTCACGCTCCGCG
ATCTGCTCGTGTTCACGCTCATCGGCGTGACCTGCGGGCTCGGCGGCGCGTGCTTCAACTATTGTGTTTACGTGCTCGTG