Description :
From Genome Similarity Track
Location :
Scaffold_13:347283- 350492
Transcript NameFunction/comments
g18385.t1hypothetical protein

Sequence
3209 bases(100 bases per row)
TAGTGCAGGTTTCTCGGCTGGTGCCAAGAAATCCGAAGCTGTGAGAGCAAAGCGAACAGGCCCCAGGACGAAAAGCGGGGGGAGGCGATGCCTTTGGAGA
AGATCCATAGCTTGAGCAGGTACTGGTACTGCTGCCATCTGAGCTGCGACCATCCAGACTATTCCTCCGCAGTCTCCACCCAAGCTTTTTCATGCGTCCA
CACTCCGCTTTGCGTCCGAACGAGAGCCACTGCGATGCTAGTGCCTGCAACGCTACATTGTTGAGCATCTCATTGTTGGTCGGGAAGTCGAAAAACCCTC
GCACGTAGCATTCGACCGTGGTCGGCGTCTTCTGTCGATACACCGAGCACACTGACATGTTGCCTCGTAGAATACCCTGAGTTTTGAATTCAGGGAGCTC
CGAAAATGCGACGGAGTGCGACAGATTGTACCCGATCCGTTCGCCCTTGCTCGAGTACAAGACGCCAGTCGAATCCAGCGAAACGTAGTCGCGTCCATGG
TAGAGCTTCCACTTGATGCCGACATGGCGGAACGGGTCCTTCATCGACGGCTTTGTCAACTCACACAGCATCTTGGTATCCAGCATGCCGTCGTTCACAC
AAGTCGACTTGATCTTCAGCGCCGCGTCCGTCGTGGCCACTACCCCGTACATCACCTCTTCCACCGTCCCGTCCACGGTCCCTAACAGCAACAACGACGG
CGAGAACGGTGCTCCACCACGAGCGGAACTCGGTCGTTCTCGGTAGATCCGCAGTGCGTCCTTGCGTCGCATCTCCTTCCACTGGCCCGAGGCAGCGTCC
GGGTAGCCTTTTTTCGTGACCAGCAGCATGTTACACTGCTCCAAGTTGTGCGTCACCAAGGTACTTGCCAATTCCCGCAGCATGTTGCAGTCTGCATCGG
AGACCGTGAGCTCCGGCAGCAGATCCACCAAAGTCAAAGCGGACGAAGTCCTTTTCATCCCCCGAGACTTCCGCGGCTACCGGGAAAAGTCCAAATGACT
AAGAAAGCGACTTCTGGCGTTCGATACAGCGTGAGCGCTGCATGCTGCCTAGTTGCAACAGGAATGGCCAGCGCGCTGTCGGCCATACGTTGTCGACCAT
ACTGAAGGAACTACCGCGTCACACGTGCAGGGCACGAAGAGTCGCAATTGACGTCGCCATCGCCTGTCAGTTTAGCGAAGGTTAGGCGCATAGCCGCGCA
GACGAGATACCATTGGCTCATATCATAGTAAAAAATAGCTGATTGGCTGATGATGGGATGGCTACATCGAAGTGGTCATGGATACTTTTACGTTTGCTGT
TCATAGGAGGAGTCTACCACGGACTGTGAATTATGCATCTATCATAGAGAGAACTCGACGGGGTCCTTATCGTGGCGCTTGGTCACGAGTTCTTCTCTGG
CGATGGCGACGGCGTCGCTCTGCACGACCTCGTGGATGCAGCGCGAGCAAAAGGTGCGTTTTTTCTCGAGGATCGAGCTCTGGTCAGGCGCCACGACGCA
CACGAGCTTCTTGACGCAGCAGCGAGAGCACACAGCGTGGTCGCAGCTCTTGCAGGTCTTTTTCCTGCCCGGTAGGAAGCTGAAGTTCTTGGCGCAGACT
CGACACGTAGAGTCGGCGGGCCTGTCCTTAGGCTTCTGTTTACGTTGCACCGGCGCGAACTCGACCAAGTCTGCGTCGTCGCTGTTCTTGCGCAGACGCC
ACGCGAGCTTCTTCATGTGCGCGCACTCCATGCTGCGTGAGAACGATAGCCACTGCGTGGCGATGGTCTGCAGAGCGAGGATGGCGCTGTCGTGCGTATC
CGTCGACAGGTCGAAGAACCCGCGCGTGTAGCACTCGACCGTGTTGTTGGTCTTCTGCCGGTAGATCGAGCACACGGACATGTTTCCTCGCGCGATGCCC
AGGTCGGTGAAGGCTGGCAGCTGAGGGAAGCCGACCGAGTGCGACACATTGAACCCGACACGCTCACCCCATGGCGTCTGCACAATGCCGGTCGTGTCGA
GCGTCACGTAGTCTCGGTCGTCGTACAGACGCCACTGAAGACTCACGTGGTGGAACGGGTCGTCGACGGTAGGATACACGAGTTCCTCGAGCACTTTGCT
GTCCCTGACTCCGTCTCGGATGCACGAGGATTTGAGTTTCAGAGTCTCGTCCGTCGGCGCCACCACGCCGTACATGAGGTCGTCCAACTTGCCGACCACT
GAGCCCAGCAGCAGGAGCGACGGAATGGCTGGTGGCGACTCGCCTGCAGTGTGTGGGTGTTCTCGGTAGATGCGAATGCCCTCGACCTTGCGGGTCGGCG
TCCAGAGTCGGCTGTCAGGGTGGCCGTCCTTGGTGACGCACAAGTTGTTGTACTGCTCCAAGTTGTGGTCGACGAGCGTCGTCGCGAGCTCTTGGAGCAG
CGTTTGGTCCGACTCGGGGATCAGGAGAGCTGGCAGGAACTTGGACATGACCACGAGCTTCGGCATCGTCTCTGCGGGAAACAGCGCAAGTCTAGCAATG
AGCTCCTCGCTCCTTTCAGTGGCGCGCGACGTTTAGACTGCGCTGTTCCGGCTCGAACGAGCAGGACTCGCCATGCCTAACCAAATTTCTGAGGGCAAAA
GTAGCGTGGCACGGAGATCTGGATACCCGCTTGACAGATCTACCGCGTTAAGTCATCTTCCTCCAGAGGCTTTCGCCAAAGTTAGCCGCGGAAAAGCGGC
TATCCAACTGCCAGAAATCCAAAGCTGTGGCCGCTGGGAAATGTGGTCTTCGGCTCTCTTGAATGTTGCTGTCCTGGTGCCTCTTTGGTAAAGATGCTCT
TAAAAGTGAAGGCGAGGACGGAGCGCATCCACGGCATGGACATTGGATGACTCATGCCTTCGAGATAACTCAAAGTTGTGAGGATGGAGCTGATCGAGCA
TCTGCACAAGCTGGACCTTCATCGCCCGTGTGCTGTCCTGGATGTTTCTTCAGGGGGATCGAAATGCTTGCTTCAAATTCACGCGGTCCATTGAATCGAA
CTGTCGTCGTCGAGCAGTGTGGACTGTCCTCCGTGGATTGGTTTGCATTGCATGCTAGAACCGCAGAGCTTGCGTGCTACAGCCTTTCACCGGCTGGGAG
CGCTGGTGCTCTCTGCATGGCTCTGTGCGCGCCGCAAGAGCTCAAGTTGACCGAACGCATCAGCTTCCACCCAGCGCGAAATGTTGTCGAGGGGCAGCGC
AATCGGTGC