Description :
From Genome Similarity Track
Location :
Scaffold_33:347275- 350373
Transcript NameFunction/comments
Phyci_222043conserved hypothetical protein
Phyci_221853Hypothetical protein

Sequence
3098 bases(100 bases per row)
CTCGCTTTCCTGCCCACGCATGAACCGACCGACCGCCACGCGGCGGGAAATCGCACCGCTGCACGTGCCGTGGCTACAGCACGAGCAGTTCCCAGCTACG
AAGCAGGCCTGCAGCTCGGCCGACGGACTCGTGACCAGCGGCAAGAACTCGCTCATCAAGGTCGTCCAGGAGCTCAAGGTACGTGGCAGCGTCATTGCAC
TGCATTGCTTAATGCAACGCGGTTGAACCGTTATACTACATTCATTGCGTTGCGGAGTGATTTAACCGACAAAGTTGTGGCTGATGTGGACGGGTTTGTG
TGTGTGGGGTCGTAATGGACGCAGCGAGGTCGCGCCAATGTGGACAAGCAGTTGGCTCAGCTGGACAGCCAGCTGCTGGCCATCACGGACTACCTGGACA
GCAAGAGCCCCAACATGTTCCCGCCCCACTTGATCACAGTCGTGGAGGACGCGCAGGGTGCAGCCCCAACGCAACCGGCCGTCGGGGTCGACGGGCGGAG
ACATTGCGCAGCCGGAGCGGCTGCAGTCGCGGGCAAGTTTAATGGCATTGTCAAAAGTGAATCGGTACCACCAACCCCGGCGATGGTGGAGGACGACCTT
AATTCGGGTGCGTGGTCTGAAATTGGGGCGAAGGTGTTTCTGGTGGTGAGGTTGACGATGGTTTTGCGTTGATGCAGATACACCGTGCACGTCGACGGGG
CTGTGGAAATATTTGTATGCGTACTCGTTCTTTAAGACGATCACACCGGAAGATATGGAGCAGGCGTTGCTGCTAGAAGGTAAACCAGAACGGCGAAAAG
CGCGTATCGCTCGATCGCGAACGCTTTTCTGGGCTGCGGTGCTGATCACTCTGGGAGTCTTTGCTGACGATTTTTTTTGCTTGATACATGCGCATGCAGA
TCCAAATGCATATTCAGAAAGACTAGAATCAAGTGAAGAAGGAACAGACAAGATGCTAGCGGGCCTAGACTTCGAACGACTCCAGGATAATTTCAGCCTG
AGCAAGTCCGCCCCACAGGATCTGGACGACCTTTTCAAGGAGGTTAGCACATATTTTAGCTTTGTGGTCTGGTCCTCCAACTAACGTGTTTGTCCATCAC
GCGTTGGTGACACAGAGGCTCGTAGCTTCGCTGTGCTCAGTAGATACTCCTTCGTCATCGAAAGAGAACAAGGGTTCTACGGTAGATGCTGCACAGCCGG
ACGATGAAGACAAGCATACGAGTGACTCGACAGGATCATATGAAGTTACACTGTCGACTTCTTTACTACACTCAGTCGATCTGGAGTCATGGAAGCCTAA
AGGCCTCACGCGCGTCCTTCGTGATATCGGGTTGTTAGAAGGAAGCGAAAAAAAAATTGCTGAGCTTGGCGTGTCCAGTCCCAGGGATGATGAGGTTTCG
CAGGAGATTCGTACACTGCAGCTTCAACTCCGCACTTGTGTGGGGCAGACAAATGAAGCCAAAAGGAAGTTGCGCAAGATTATGGATGGGTATGGATTGC
GGTGGCGCCCCAAGGTGTAGCAATACTGATGCACTAACAATGTTTACTGTTGTGGTATGCTGCTACTAGAACGAAACCATGGCTTTCTCAGAAGAAAGAG
AACGACGATGCCACCATAAAGAAGTACTTCACGATGTGGCAAACGAAGAAGGTACGTTGATGAAGATACCTGCGAGACCGCAGCGAAACAGCAAACCACT
AACAAGTTGTGGTCATCTCTGTTGAATAGGAGCTTGCGAGAAAAAAGAAACTTCGAGACAAAAAGCTCCAGCGACGACAAGGTGCATAAGGATACTGCTA
TCCAGTAGCACGACGACATGAAAACTAACCTCGGTTTTGTGCTCGATTCGGTGTAGCTTTACGCCTCGGTGGCGGTGGCGGTAGCGGCAAACCTCTTGCC
GACGACGTCGACGTCAACGTCAAGCAACGATAGACCTCGGCGTGTGGTCCACTGACGTAACCAGCCCATGGGGATCACTGTCACCAGGACATTACGTAAA
GTGGCGCCCACACCCGTTATTTATTGGCACGCAATAACAGGTCGAACTCGATCGATGATAACGAAAGTATATCACTGGTTCTACCTTTCATCGATGTCTA
CGAGACTCTATTACAGTATAACCATGGAATGAAAAGCAAGTTGGCTGATGGATGTAATTGTGTCGTTTTATTGTTGTTAGGCGTGTTACTTGCCGAGCGG
TGGGAAGTCGTCCTCGATGAATCCACCGCTGCCACTGCCCACTGCCCGAGTGTTGGCTGTCGGCGGCACCCAGTTCCCCTGCCGCGCCGACGGACGGCCT
TGGGGTGAAGGGTACCCGTACCCACCACGTCCCATTATCATGGAGGGCGGCGGGTTCAGCTGGTGTTGCTGGAATTGATGCTGCGGATGGTACTGCTGGT
GTGGGGACCTCTGGTACGGGTTGGTGTCTACTCTATTGTTGAAATCGGGTCCGCCAACGTGATAGCGGGCACGTCCGGCCATGGGCATCGGTGGCGGTGG
AGGAGGCGGCGCACTGCCACTTTGCTGGTGCTGGTAGCCGTAGGACCGGTCATAAGATCGGTCGTACTGTTGGGATTGGTACTCGCTGTGTCCAAATCGC
CCACCACCATAGCGGTTGCCGTGGTATGGAGATTCTCCTCCGCTTCCGCTTCCACTAGATGCACCGCCACTGGAGCGTGGGCGGAAGGCGTCGTGGTTGC
GCGTAAAATCTGGGTCATTCATTTCCTGTTCGCGGTTGCGCCACAACACCTTGCTTTCTTTCCAGTTCGCTGCGTTCGGGGCACTCGGTTGGGACGATCG
CGAGTACTCATTACTGTCAGCGCCATCATTACCTCCCGGTCTTTCCTTAGGCGAACGCGAGTCCCTGGATTGAGTCGCATTGCCGTTTCCACCGGCAGCG
ACAGCGCCTCGACCTCGGTCGAAGCCTCTGCTGCCATCGGGTCCAGCTGCTTGCCGACTTCCAAGTCTAGCATTGTTATTGCCCGGTCCAGAACCGTGTC
CATTCCCGTCATGCAACGGCGGAGATGGCGATGAGCCTGAATCAGCCGCCGAGTTATCGTTATCTTCTCCAAAAATTCGTGCTCGTGCCTCGGCGTAC