Description :
From Genome Similarity Track
Location :
Scaffold_60:34727- 40887
Transcript NameFunction/comments
Hyaar_Emoy2807170hypothetical protein
Hyaar_Emoy2807171hypothetical protein
Hyaar_Emoy2807172hypothetical protein

Sequence
6160 bases(100 bases per row)
ACCCTACTCAAAGGTTATGGGGTGGACACGAAAAACTTCGGTCCGAACGACACCAGTACGGTGACCTTCCATAAAAATGTTGACACGGACTTCCTCAGAA
ACGAGATCAAGTTGCAATGCAGCAAGAAGAGTTCCCAACCCTTGGACATAGTCCGATAAATACGTCCTCCCTTTTCGGGAGGATAAGAAGCGTGAACGCA
CTCGATAAGCCTGAGTAGGCAGTGCGAACAAGCGGTACATCTTTTTCTGAAGCGAATCTCACGTAGGAAACGCGGCGTCTACAGACGCATCACACGTCCA
AGCCCATTCTATGGCTCTGCCGCCAAGTTTTGATATGGCCAGGCCAGCCCTCTGCTGCTCGGTTTGCAGCATAGCGGCACCCATCGCCATTTCGACTTCT
CGAATCGAGAGAAGGAAATTTACTCTCGCTTTCCTTTCGATGGTCTTTAGTCTCCAAATGGGCGGCCAGACTTAGGCTCCTCATCGGATATAGGGATGTA
GCGTGTTGGCATAGGCGACGCTGTCTGGTCATGGACCTGTCCGATTAAGGTGGCCTCAAATTGCACTAAGGCTTCCATCCGCGCATTGAGCACTTCTGGG
CTTTGGGCCACAATATGATCGATCTTTTTCAAGCCCAATCAACGCTCTAAGCTTATCAAGTGCGATGAGTTGCACCTAAAAGAGATCGGGTAGACTCTCC
ATTTCAATAAAGGATTAGATGTTTTACGACTACGGCATAGGATTGACTACAAATGCTAGCAAGTGTAGTGGAGTTACACAGCTTTTAGTCAGAGGAAGAC
TTACGACTATAGAAGTCACTTAGTTCTACGGAGCTAAGCTCCTATTAGTTTAAAGATTCTTTAGTTCTTAGAACTGATCAGCCAAGACTCGGAGATTCTT
TAATCTCGTAGAGCTTCTAGTCCTGGTTCAGGGACTGACAACGACTCTAGGAATCGTACACACAATGTGATCTAGCGCCTTCAGCTGGCTCTTAATCGTA
ACGGTTTGCTGACGTCTAAATTAGACACGTGTCAATCAAAGATCAAAAGGGAAAATGAACTTCTATTTCTTAGTTTTATCCGTAATAAACCTCATTCAAC
GACCTAATACTAAGGTTAAACTAATTCGCATAGTATCTTCAGTCCATTACAGATTGATGGATGGTACATCAATGTGTCATCAATGGATGACTGAGGTTAT
CAACCACATCAATCATCAAAGATAGAGCTTGGGACTGTATATCACATATACAATGTATATCCCTTTAGAGCGATAACGGAAGTGTGACCCCGTTAGACAT
CATATAAGTTGTAGTCTCGAAGTAATGAAAGTTCTATTCAAATGTAGCTAATATCCGGGAACTTAATCGGATGTGGAGTGGCTTGAAGGATATTGGATAT
GTACTTGATCGGGTGCGGGATAACAACTTGGACATTGAAGTTGCCACACTTGATTTGATACTTCCTGGTAGCCCATAGTATCGTGCCCCGTATCATGTCG
GTGATCGACCGGAAGAGGTGGAGTCTGTCCACGATACAACTGATTGTAGCATTGTCTTCTTGGGGCGGTTTGTCTTCTCGGATGATGTTCAAATTGTTAA
TATGACTGGCCTTGCCTCCAGACACTTGAAACAATGCTTTATCGCTTATTAAAGCTGCTACTTGATAAACTTGTCCACTAGACGACATGGAATCACTGAC
ACTCGACACCTCTGGCAGAAAACCATCATGACTGGCGTTGAAAGGTAGGACTTGAGTGGACTGTTGAACATCATGGGTACAATCAAAATATACAAGTGCG
TTAAGAATGCCAATACCACCTACCTGTGACGCCTGTTGCCGACACATCAGGTCGCATGTTTCCATCAACCTCGGACTGCTGGGGATACGTAATATAGCAG
TCTTTATCTTGCTGACGATTCTCCATCCGTAAATCTAAAATCAGTAGCTTCATAAGTCGCGATAGGATCAAATGAAGGTAAACAACAAGCTTTGCAGCAT
GTAGCTGGCTCGAACCTGTCTTACGTCAGTGCATCACCTTGGAACGAACTTGATTTACGTCAGTGCAGTACTTTGGCGCGGACCTTCTTGATGTATATTT
CCGAACGCTAAGGAGTAACGTTTAGTAATGGTGTAGGGGGAGAGGACTGTTGCCTTAAAATATGTGATACGTTTGTATTGATTGCAAGACGCGGTGCTAT
GTACCGCTGTCATTTTGCCATGTGTCAAGAAGAACACAAATCACGATCCAAAAACAACTGATTATATGTATTTGTGTAGTTGGAGATAGAGTTGGACATA
GGGAGTCTATCAGTTGGAGATGTTTAACGCGTCCCATCTTTAATTTGTGCAAGATGCAAAAATCTGATCCAGGATACGAGCGCCGGTCATGACAGGGGAT
CGTGGATGACTCGCGCGTAAAGCAGGAGCCCACGTGGCTCACAAATCAATATTTTAAGTCAGGCATGAAGCCGGGCCCCACTTATAGCAGTAGCAGCAGT
TCGATGATCGCGTATTTCATTGGCTTTCAGCTGACAAATACCTTGTTTCTAGTAAGTATTGACGCTTGCCGATGGTGAATTTGGGACTTCTTTGAAACTG
CCACATAGGGCTAGCCCCACAAAATTTTCGACCGATGGAGCTTAGGTAGAACCAATTGCATTCAAATTTTGTTGCGGTGGCGTCGTAACCATCTTGAAAC
TATTGTGCAACCACAGACGCAACCGACGTGGGATCGGTGGAGCTTCACGATTATTGCAGTAGATGAACGATTTGTAAACGATGAGTTACGTCGCGCACTT
CCCATTCCAGTTGCTAATTAATCGTCTTTAGACGCTTGTGCGTTTGAGCAGATCCAGATATTGTGGGCTGTATTCTTATCGAACCCGTTGCATTGTACAG
CAGATATTGTCCGGCAATATAGAGGACAGACGTACCAATCTGCGAGCGATGGTATAGACGGCTGGCACAACCAACGTCAGAATTTGGTAGCATTGTATAA
AGAAAAAGTGGGGTCACTTCCTTTAAAACAAGAAAAGTATTGAATAATAGTATGCGCATTGTGGAAAGGAGTTGAGACTTAAAAACATTCGTCGGTAGAT
GCGTGCACCTCAGACAACCAGGATCATAGAGGGTAATACACCTGACACAATCATCATTTTTAAACAATATGACGACAAAACATTAAACTTGACATTGATC
GCTAGCGCTCATCTACACCATGCTTTGAGCGCTGCAAAAGGATATTCTTTGTTCAGACGATGAAAACACGACGACGAAGCTGTTTGGACGAAGCTAGGCC
TCGTCCTTCGAAACCGTGCCGCAAATCGCTACGTCAGTGTAAGACAGTAAAACCTCGGTTTCTGTTCAGACGTTGCCATCATCATTTGATTCTGTTCGCC
ACTAGGTTTCAGCGCAGTTAAGTACTAACTTGTCGAGTGCAGAGTATAGTCGGCGAGATTGGCCTTCCACCACAGTCCATCGAAGTTAATCCAGTGATGC
AAATTGTCATGCCGCCGAGTCGTGCAACACGACTGAGCTGAATGTATCCTGGATAGGTCATGACGTCACAGGCTGACGTCATTAGGAACATTCTAGAAGG
ACATAGAATGATAGGCTTAGAGGTAGCACAGGGTAGCGAACTAAGGAACTATGTCAATTCAGTTTTCAATTTACTAAGTGAACGACAAGTCTTCACATCT
GGTAGCACTTGTTGGTCCTCGCCGTCTCCGCCATCCCTACTGCACCGCCGTCGTCACTCAAGAGCAGTGATCAGCGGAGCCCATTTGTAAGTCCCGATCT
TTTTGAGGACAGGGACTCCTTTTCATTGGCTGTAAATCCTTCCGGGCCATTATCACTGCTGCTGTTATCGAGATTGAAGTCTTAATTGGCTATAAATCGT
CTCGTTTCAGTAATAAGTCAGTTCGGTTAACGGAAGGTAAGTTATTCGGTTTATGACCCGTCACTCGCGGAAGCAACCCACGAAACTGGACTTCAACGAC
TCCCTGGCCCAGCTGTCCGTGAAAAATCCAGACACAGCCGATAAGTGCCGCTTGGATCTGCTGGAGTAGATCCGCCGCACCAGCCGTATCCTTTGCCGCT
ACGAGAAACACCTCGATACGTCTCACCGCTCCGACTCGCACAAAAACATTAAAGCTCGCTTACTCTCGCACGCCAGTGACTTGCTCAGCTTCGAAAGTAC
TGTAAACCTGCGCATCTCACGCGAAATCGCTAATCACCCAAGAGCCGAAAAGGACCCCAGATCAACCACCGAGAGTTAACTAATCGTTAATATCATTTAA
TAACTGTATTAGTTGAACAATGTCCACCCCGATGAATTCCGATCAGCATGCACAATTTCTCCCTCTATGGTTGCAACTAAGGAAAAACAAGCGCAATTGC
TCGAACAATTTCAAAAATCAAAACAGCTTTCGGAATAATAAGCTAGAGGGTGTGAAACTTCCGACCTATGCGGGTAGGTTGGATGAATCATTTCAACTCT
ACAAGAAGCAAGTGGAACAATACTTCTTTGCAAGACGAGTGGACTGGAAGAGTCTAGAACTTTCTTAAGGAATATTCGCTGTCTTAGGCGGGACACTAAA
GCAAGGAGCCGCTCAGTGATATGTGATGCAAAAACAGTATGTCACAAATGTGGACGACTTCTTCAGCAAAGTCGAACGTGAATTTGTTCCGGCTGATTTT
CAAGAGCGTCTGCGCGAGGATATGAACAACATGAGAGAGCGCCATTGCGAAGATCTCCCTGATTATGTGTGCAAGTTTCGCCACGTAGTCACTCAAGTTC
GAGAGATGAGCGAACTGGACCAGATCATGTACTTTATCCGTGGACTGACGGGTCGCACGCGGAAAGACGTTTAGTATCGTCGCTGTACAACACTCTCCCA
AGCTATTACGGTTGCGTTGGACTTTGACCGTTCCCATATGCAGAGACATTCTCGAGGAATTTCGCACGATTCACCGCGGTACAGGTCATACGAAAACAGT
CGTCGATACCGATCGAATGATGGTCCGGAGCCAATGGACATCAGCTACGTGCAAATTCCGTCTCGTGACGAATGTCGCCGCCGTAATTTGTGCTTTAAGT
GCGGAAGTCATCGCTCCGCCCAGTATCGTCTTCGTCAGCCACGTAATGATCGAGGTAACAATCGTTCAGACCGGAATTATCAGCAAAATGTAAGTCGTCA
GCATGTCAACAATGTGGACAGCCGTGAGGATGAACAAGAATCAATTGTTTACGAACTTGTCACGACCAATGCCGTGGAGGTCCAAGAGAAGACAGAAGTC
GAACCTATTGGCTTTGAATCAAGCAGCTTTGGATCGGACATGCCAGTGCAGGGTCGACTACTAGTGCGTGATGGTGTCATTGGAAACAAATCCGTCAAGA
TTTTGATCATCTCTGGTGCGTCCACAAATCTGATCAAAACTGGTCTGGCCTCCAAAATATTAAGCGCACAAAAGGTACAAGCGCGTCGTTTTAACGGAAC
GTGGACATCGTGTCGGCCCACGAAGAGAGTGGAAGATACTGTTCGCAACGACGGTATGGAGTTCCCAAGGATGCAGTTCATGAATTGGGACCTACCGGAT
ACGCATAACTTAATTTTTGGTCAACTATAGTTTACCAAGTACAACCCACGGATAGATTGGCGATCGTAAAATATTGAAGTTGAAGCCCACACGAAGTTCG
AAGACGTGGATGGTCCTACCTTTCAAGAGAAGCTGAACAGTGGAGCATATGAGGAGATTTATCAGCTGAAGGTTACCAACGTCGAACCATCAGAAATATC
GCAGGAGTTGAAACCAGTCCTGGACGAGTACAAGGACGTATTTCCAGAACAACTTCCCAATGAAATGCCTCCAAAGCGATCAGTGAACTTCGAACTGCAA
ATAAAGCCTGATGCGGTGCCGAGCGCCCGTGCTCTCTTCCGTCTTTCGAAGGTTAAGCAAGACGCACTGCAGCAATTCGTTGAAGAGAATATACGTAAAG
GATGGATAGAAGTATCCAACTCGCCATTATTTTTGTAATCCCAAAGAAAGATCCCACAACCGGAAGTTCCAAAAACGCACCGAATGGCTCCGAAGAAGAA
ATTAGAAGATTCCCATTCGCTGGGTAATTGACTACCGCTATGTGAATAGCATGACAGTCG