Description :
From Genome Similarity Track
Location :
Scaffold_29:34721- 35787
Transcript NameFunction/comments
Physo_133936predicted protein

Sequence
1066 bases(100 bases per row)
AGTACCGGATCTCGCCGTGCGGCGTCACACGAACCGCGTGGCGGTTTCCCGGCAAGAAGTCAAACGTGGCGTAGTGGAAGGTCGAGCGGTTGTTCCAGAT
CGCCACTGCGTCCTTGGTCCAGTGGTAGCGGACTTGAAACTCGTGTCCTTCGGTGATGTGCTTGTAGAGAAATCGCAGCACCGCATCTTCAGGGTAAGCG
AACAGTTGTTAGTTTTGCAACAGCAGTCGTAGCACTGGTTGTATATCCATACAGAGGGAAGAAACCTACCCGATTCAGCTGCAGACAGGTTATTGATGCG
CTTCGTGAACGCGGCGTTTACGAAGAGTGCTTTGCGCTTTGTTACGGGGCGCGTACGGACAACAGGGTGCTCGAACTCAACCACTGGGCGGCGAACGATG
CGCCCAGCTTCGATGGCATGTTCAGCTTGGCTCTGCAATTGACATATTGTTAGTGTCGCCGACGCAGCGGTAGAGTAAGCTATCCGTAGAGTGATCGTAC
CTTTCCGCTGTGAACCGCGACGAGGCCCTCGAGAAACTTCTTGAACGCGGGGGTGAGGCGGTCGTACGCTTCGTAGCCGCATGCCCATAGCGTATAGCCA
CCGACATCAGGGACCGTGAGCGCCGTAGTACCGCCCAAGCTCCAATTGCTGCTCGGCCGTGATTTTCTGGTCGCGAAAGAATACCACGCCGCGATGGGCG
ATGAGCAGCGCCAGCTCGTCCTTCTGAGCGTCCGTCAGCTCGTGTAGCTGCAGGCCCGAGACCTCCGTGCCGATCTTCGGCTCCAGGTGCGTCACCGTTG
CGTCGGCCAGCAGGTTCTTGAACGTCGGGTCGGCCTTGAGTGCGCGGTCCTCGTACGGGACAACCGGGATCGGGTCGTACGTCGTAGGTGGGAAGGTGCT
CAGCAGCTCCGGGTGCTCGAACTTAGCGTGCTGCACTTCCTGGAATAACGCATTCTTCACGGGAATAGCCGTAGGGGCAGCGGCGGAAGTCGTCTGGGAG
TCGGTATCTTGGTTCTTGGGGCCATGGTTGCTGGGTCGTTGCGCGCTTAAAGCAAATTGGAAAGTG