Description :
From Genome Similarity Track
Location :
Scaffold_568:3472- 12017
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_568-abinit-gene-0.12Sporangia induced dynein heavy chain

Sequence
8545 bases(100 bases per row)
ACTAGACAACGTCCATGATGAGCGCGACGCCAGCGAGGATCCACCTGGCCGGCGGTGACTTGGTCTTGAGCTGCGCCGAGAAGACGTAGGTGGGGCCGCG
GAACTCGGTCTTGTAGCAGGGACAGAGGAAGGAGCCCTTGAGGTCGAGCTTGTCGGCGGCCACAGCCTTGCAGTTGATGACGGGCATGGGCGAGAACATC
TCCTTGGGCTGCGACTTGTCGACCGTGTTGTTGGTCGCGTCCCAGCGCGCACCCATGAGGAACAGTCCGTGCACGTACGCGCCGTCGCGCGAAGCCGCGT
CAATCTCCGAGTGTTTGCGCTTGAGTACGTCCGTCTGAATGACGAGTTTGTCGAGCTCCCATTGGTTCTTCTGCGCCGTCACCTGCATGATGGCCGTGAG
GAAGGACTGCGGGTTGATCATGCCCGAAAGCCACGTGACCTTGGGGATGTCGGCCGGGTTCTGCGTCCACTCCTCAAGCTGGAGTAGCCTCGCCTCGAGG
TTGGCGAGCCACGACCCGAGCGGTCTCAGCGACGGGAACGCCAGCTTCTCCCACGACTTCGGCACGCGGTCCAGGAAGAGCGACTCCTGCACTTGCTCCA
TCGCGTCCGACATGGTGAGCTCTCCCGCGAAGCCCAGCTGCAGCTCGTTGAGCGAGCGCACGATCTCCTGCAGCAGCACGTTCATTGCCTCGCACTCCTG
CAGGAACACGTTCTGGTACGGTCCCATCTCCTCGAGCGCGCGCGCGATCTCGTCACACTCGAACTTCTTTTCCCCGACTCGCCCCATGACAGTCTCGAGC
GCTTGCTTAGCCAGCTCGGTCGGGCTCATGGCTGCATCACCAGCGCTCGCGTCGCGCGGCTGCAACTCCATAAGCGTGCGGAACAGATTGTCCGACTGCG
TCGTGCGAAAGTCGATTTCAGCATTCGGATGCAGCCCGAATGCCAGCGGCGAGTCCGTCTTGAGTTCTGACTCGATGTGCTCCAGGTACTTGTCGTAGCT
CGACGGCGGCAGCGACATGAACGACGGACCCTTCTCGTCCCCCACGAACGGGAACATGTCCATTTCGTCCAGCAGCTCGTCACGCATGTAAAACTCGAGG
TAGGTGTTCGCCAGCAGCCGATCAAAGTCGTTCACGATGTGCCCGCCGTACATGATCTCGCCAAAGATGTACCGCAAGTCCGCCCACGGGATCTTCCCGC
CCGCTGAGTTCTCCAAGTAATTCTGGAGGCAAATGCTCGAGTCGCGCAGGTCACCCAGCGAGAACGGATACATCATGTTGAACCCCAGCGGGCCGTACAT
TTTGCGCTCCATCATGACTGCGTGGAAGTGGCAGAGCCCGAAAAGGATCGACTTGACCTTGCCCTCGGCCTCCTCGATGTACTCCTTCGGGAAGCTCACA
AACGCTCGTTTGAGATTCGCCTTGAGTCCCGATGGCGGCTCGTTCGTCAGCTTGATGCACCGGTTGAGCACGCCGATCGGGATCGAGTTCGACGGGTCAG
ATGTCAGGAACAGCCTGAAGTTCTTGTGTGAACCCTCGAGCGCAAACTCATCCAGCTTCTTCTCGAGCGCGAGCAGCCAGCGCGGCATGAGGTGGATGTT
GTTCAGGATCACCCAGTGGCCGTTGCGGTGCGCCACCTCGAGTCGGTCCATCGCGAACACATCCTGACCCTGACCCATCGACACATTGTGGTAGCTCACG
CCACGCTCGAACCCGTACTTGACGCTGAGCTTGTCCACTCCCGCCACCACATCGGCACCCGGCGACAGGATGAAGTATAGCGGAGTGGTCGGCGTCGAGT
CCAGGTACGAGTTGTCCATCACTTGAATGGCGTTCAGGGCCGAGTCGCAGTCGCAGTAGTTGCTGCCGTTCGGCAACACGTGGCGCACAAACTCCGTCAC
GGCAACCGTCATGCGATCCGGACGCAGACACCGAACAACCAAAAGCTTGAGGAACGGTGTGCGGTCCAGACCGGCCCAGTCCAGCGGCAGCTTCTCTGAC
TCGGGTGTGACATGGTTGTACCACTCGCGGAAGCGCGACGATGCCTCCTTGAGGTCCTGCGGCATCTTTTGGAACTCGTCGAGCGCTGCAAGTGCATTGA
TGGAGTTCCACTGCGCGTTGGGAAGCCACTCGATCGGGTTGGGTTCCGCCTCGCCTCCTGCCGTCTTCTTCGGCCCTCGAAGCAGAAACTGCATGTAGTT
TTCCTGCACTCGCGCGTCCTCGCCGAGAATCCCGCGTCGCATTAGATTAAACGTGAGTTGCGAGAGGAAGATGAGCTTGTGCGCCTCGAAGAGACCGCGG
GACACCCACGTGTAGATAGTGATGCGAAGCGACTCGCGCAGATTGAGCACGCGCTCGCTCTGCTTGTCGCTCTGCACAGCGCGATCAATTGCGTTGTAGA
AGAATGTGATGAACGAGTCGAGACTGTAGCGGTACATGTGGTCGATAGCGCTCAGCGTCGTGAGCAGGAAGTAGAGCATGGCGCCTTCAGCCGCCACGGG
NNNNNNNNNNNNNNNNNNNNNNNNGTGCTCGCGTGTCGTGTTGATAATCACCTCCGTCTCTTGGTTCTTCTTGACCGATATCGAGATGTCGATCGCCTTC
TTCTTGGTCTCCTCGAGACTCTCGATCAGTGGCACGTCGCTCAAAATGTCGTCTGGCGCATTCGCCAGTCGCTCCAGCAGCTGGTCCTCAAGTTCGACAA
GATCGATCTTGAACTTCTGGAACGCCAACACGAGCTCCTGCTTTTGTCGCTCGAGCTCGGGCTGTTCCTTCTTGACAACCTTTTCGAGCAATTGGTCTTC
AAGACCACTCTCAGTTGCGATAAAGTTGATGAGTGTGCACTGCGCTGCGATTTCAGGCTTGTAGTGCGGGTTCGACAGCTTGGTCTGCAGGTACATGAAG
AAGCCCGGATCGTACTGAACCTCCTCACCAGCGAGTTTGAGAAACAAATTCGAGCCCTTCTTGTACACCGCGCGACCGAGCACGGGATCGAGCGTCGCGT
CGATTTCCTCGCCAATGTTCTCTACAATGATAACGTTGCCATTCACGATCGCACTCTCTGTCTTGCGCAGCCATTGGTTCTGAGTGAGCTGCATGACAAT
CAGCCCGCGATCCTTCTCCTTCTCGCGCAGCCACTTGATGCCCTGGAGCTGAGGATCGATCACGAGCGGCCAGCGCTTGCAACTCGTAATGATAGCGCCG
TTCTCGATCGAGATACGGTCAGCCGGTAGCCCCTCACTCATCATCTTGGCGTTCTTGCCTTCAGTCGTAAGCATTGACAGCGGATCAATGCCGTCTGTGA
TAGGGATGTTCTTGGCAACCAAGTCCGGGAACCATGTCTGCTGCCACAACTCCTTTCGGACGACTTGATCAAATGCTCCTATGTACGACACGAACGCGGC
AGCGAGAAGCGAGTTGCCGATGACCATGACGCCAGAGTTCTTGAGTTGCTCGATCTCAATCCCCCAACGCTCGTTTTCACTCGCGAGACCGTTGACTAGT
TTGCCCGCAAGCAACAGCCGGTTCTCGCACGACTCCTTCATTTGCTCGACCTTGAGCTTCTCCTCGGTCGCTTGTCGCAGTGTGTCCTCGAGCATCTCAA
GTCGCTTTTGCACTTCGGCGACCTGGCCCATCGCCCGGCTAAGCTGTTCCTCGGCGTCCGCTTTCGTCTTCTTGGAAGCCTCGAGCGAGTCCATGAGGGG
CTTGACGCGCACGTAGATGCGGTTAAACGTGTAAATGTTCACGACCCACGAACACAAGTTGGCGGCAGCTGAACTCTTGGACGCCATCTTCTCAGCCGTG
AACTCCGGATCAGCAATCAGTGGCTCGATCCGCGCAATATCCGCCTCCGGAATGTCCTCTCCCTTGAATACCTTCAGCGAGTCCAAGAACGCGCCAGCAT
TGTTCATCATCTTCTTGGCGCGATCCCATTTGTGGTTCTTGTACTCCTTCTCGACCAGAATCAGGCACGCTTTCGTTACATTATCCACACCGGCGGGAGG
CTTGGGTAGACTCTTGAGCTCAGTGATAGCAGGTTTGGACAGGCAGTCGACTGCTGAGGCGGCAGCATCCATTGCAGGTTTGGCAGCGCTCAGCTCCTTC
TCTGCCTCGGCTGCCAGCTGAGCTGCAGCCGCACTCGCCTCTTCGGCCTTGGCCTTCTCCTTGTTCGCGTGTTCTTGCTGGACTTCAGCACCAGCCTTTT
CACGGCCCATTTGCTCGAGCAACAAATTGGTCGACGCCTGTTTCTCCGCCACCTGGACCATTGTATGTTTCAGGTCGACCTGAAGCTCGGCGACATCGGC
CGACGTCTTTCGCAGTGTCGAGAGACCATCATCCAAGCGAGTGATCTGGCGCTGGATCTCCTCCTTCTTCTGCTTCAGCAAGATCTCGTAGAAGTGGATC
AGCTCCAGGAAACTCTTGGGCGTCACGTAGTTGTACCGGCGCTGCGTCTCAAAGTACTTCTTGCTCATTTCCGTCACAGAAATGTGCACGTCGGCCATGT
GATCCGCCAGATTCTTTTGCAGCGCTGCGTCGCCAATGTCGTCCATTTTCTCAATGAAGCTCCCAGCCACTCGCACCAGTGCATCGCGCGGCCATGGGTG
GAACCAGTCGATGACTGTGCAATTCACAAGGCCAGGGAACCGGCGTGCACGAACTCGGAAGACGGCGCCGACGGGGGAAAAGCACATAATGATTCGGAAG
TTGAGTCGAATTCGCAGCAGCAAGAAGTCCATCAGCGTGTCCGGTGTGTCTGGCACACCGTTGGCCTTGGCTTCGTTACGTAGTGCGCCAAGCAGTCCAT
CAATATCCTCTTTCGGGAACAAGTCCGGGATCCACCCAGACGAGAGCATGTCGTTGATGTAGACCAGGAAGCGCTCGTTCACGATCTGCGAGTCTGTGAT
GAGGAAGACAAGCGGCAGCCCTTGAATGCCTGTGATCTTGAACATCTCCGCCAATGACTCCTTGAAGTCTTCGATCCGAAAGTTGGACGTGACCGACAAC
TGACGCACATCAAAGCCGCAAATGTGCGACGCTAGACGGGACAGCGACTGCTTGCCACTGCCTCCGACACCGATCAGCATGGCATTGCCGCCTGGGTTGC
CGATGATGCGGCAGATGCGCGTCACATGCTCCATTGCATTGTCGAACAGCTCTAAGTTCATCATCGAGTACTTGGAGTTGTAGTCGTCCAGCTGTTCCAC
CAACACTTTGTTCAGGTGCTTCATGGACGTGATCGGCAAGTAAGCACTATCGACTCCAGCGACTTGCGTGGCGAACGACGTGAAGATGTTGACGTTTGTA
CCAGCTTCGTCCGTGGCGCTAGGCGGCTGGTCATCGAATAACACAACCTGATCCAGATCGGGCAGCGTCTTCTTGGCGATTTCACGGATACGGTCGTTGA
ACTTGTGGATGTCTTCGTCGTTGATCAGCCGGTCACAGAATACGCGTGTGGATTCGTGAACCCATAGCCGTGCCACGTGCATGACCGTCGGGAAGAAGTC
GCCCTTGGACCGAGTCAGTCCCTGGAAGATATTTGACAGCTCGCGCATGTTCCAATTGTAGACAAACTTGGTCGCGCTTGGGAGGAACTTGGCGGCCATG
TCTTCGTGCAGAAGGATGGATACGTTCACGATAGCATCGCATGCGGCTGCCACGTTGGGTGGGAAGCCACTGTTCAACAGATGGCCCTTGAATATCGACG
AGTATATGGTCTTGAGGTCTTCCCGCCCTGGCATCATGCACGCGAACAAAGCGTAGTGGCGCTGGAGACGCTCGTCAATGATAAACGATCCTGCCGTCGG
GTTCATGGATGAGAGGTACTGGACGTCCACAATCTCCTTGCGGAACCCCAGGTCCGTGCGATCGAAGATGGTGCGGTAGTCCATGTGCTGCCGGAGCAAC
GCGAGCGAATTCTGCGTGCCGTACGTCTCGATATAAGGGAGGTTGAGGTCGTCGATGAAGTAAATGAGTCGCTTTGTAGCCGGCGGACCGAACATGCGTC
CGGATCGTTTGTCGATAACCGACTCGAGTTGCTGTTGCAGCTTGGCCGAGTCCGTGTAATAGTTCATGTTGATCATTGAGAAGAGCATATCCTCGTCCAG
ATCACGTAGGAAGTTTTTCAGAATCGTCGTCTTGCCAGTTCCACTACCGCCAACGAGAAGGACAGGCCGCTGCCGAGAAACGAGCGTCTCAACAAGGAAC
CGAATGCGCACCGAATCGTTGGTGCTGATGACGATCGAGTTGAACGGCGTGTCGGTCGGACCGTTGCCGATCGTGTTGGGAACGTACTTGGGCACCTTGC
TGTTCCAGTTCTCGAACTCGTTCGTCTCCGTGTTATAGAAGTAGTCAAAGCAGAGACCTTCCTTGGGGTACTTGACGTTCGTGAACGCCGTGGTCCACAA
CTCGTGGAAGTTCTTGCGGTAGTCAACGTTCTTGTCGACAATAAGCGGTCCGCCGAACGCCCAAGTCGAACAGAAGACGAAGATGGACTCGATAATCTCC
TGCGTCTTCTTCTCCGGCGGGACGGTGCAAAGCAACCCCTCGAGCAGGTAGCAGATCGTTGACACTTGGTTGATAATACGGACAGGCGCGACTTGCTTGT
AACCTTTGCGCATGAGGTCGTACGTCGGGTCGATGTACTTGTCGAACAAGCCGGGGAGGTACGTGCGCTCAATCTCCTCCTCACGCTTGGCAACCCACGA
TTCCATGAACGGACGCCAACCAATGTCCGTCTCGTTGATGAATAGAATGCCAGCGCGAGATACCGTTGCTGGCGTCGCATTCTTGAGCGAGTTGATCTCA
AAGAACATGCGCATGGCATTGCTCAGCGGGATACGCTCGTTTGAAACGAGTGTCAGCACCTTGTTGTCATCCATGACGGTATTCATCGACTCGATCCACA
CAGCGTCAATGTCGCCGTCCAGGACGACCCATTTATAGATTTGCGACTCGTAGAACCCTTGCTCGGCGTAGTTCTTGGCCATGCCGCGCATTATGATGGA
GAGCACACCATCCTTCCAGTCTTTGGATAGCGTCATGTACCCGTACAGCTCGTCAGACGTTACCGCCTTTGGGTTGAGCGTCTCGTAGACGCAGATCTTC
TTCTCCTTCCCGAGGTTCCAGCATTTGGCCAATGCTTGCCAAGTTGTCGTTTTGGCGCATCCAGCTGGTCCGAGCAGCATGACAGAGTGGCGAACATCAA
TGAGCTCCTGGAGCTGGCAAACCTTGAGGATGAAGCTATCGTCGTGCTGGAGGTTGTTGGCCTTGCACACTCTGACCACCTTCTCGCGCAACTCCACGTT
GACTTTTGGCGCAACGTCAATACCGATGAACAGATCGCTAATCAACCGGAGGAAGATGGGCGTGTCGTTGTGCGGGATCTTTGGCGTATTGAAGTCTCGC
AGCGCGCGCATAAGCACCTTCTCCTCCTCCACATCGGGCTCGGCACGTTTCAATATGCCAGCCACACGAAGCACCGACTTGACAGCACGAAGACCCCAGT
CGTAGTGAAATTGCTTGGACAGCAGCTCGCTGCTCAACTGATACAGCGTCACAAACTTGATTGCAAGCGTACGCGCCTGCTGGAACCCCTCCGACATGAG
CATATTCTCGCAGATGGGCTTCAAGTCCGGACGGATCATGGCGCATGATCGGAACAGCACCTTGAGATTCTCCGGCAATTCGGTTCGGCCCGCGTACCCT
GGGTTCATAGTGATGAAGAACCCACAAGTGGGAATCAGCGTAATGCGGTCGGACGCCCCCATGAACTCGAACTCTCCGACGACGACTGGGGGCGTTCCGG
CAGGAGCCGTCTGGTATTTTTGTTCGCGGTTCGCAGGGATGGCATGGAACACAATGGCGTCCTGCACGCACTTGACCTGAGTGGCCACGACACTCAACAC
TTCAATGTTGATGCGGTTAAACTCGTCGAAACACCCCCAAGTGCCTGTCTGGCACAGCCCGCGGAAGATGTCGGCCATCGTCTGGTAGTTCATCTGATCC
GAGCAATTGAACACATAGCAACACAGCGCCATTGCTCGCGCCAAGTCCTTCGTGGTTTCAGTTTTGCCCGTGCCGGCCGGGCCAGCTGGAGCGCCGCCGA
GGAAGAGGCGCAGCGCCATCGTCAGCGTAATGTAACAGCGGTCTGTGAGCGGCGTAATCACCAAGCGTCCGGTATTGCCAATCCACTCGTAAGAGTACTT
GGAGCGGAAGTCCGTGATGCGAATGTCAACGTCGTAGTTCTCCTGACGCCAGATAAATCGAAGCTGTTGCTGCCACAAGAAACTGAGTGGCCCCTCCACT
TTCTCGTCAACGAGGCGCTTCACGACATCTCGAGAGTGCACATCGAGAGTGATAAGAGCGATGATTTTGCAGCGATCGGGGCTACTGAGATCGCCAAGGA
CGAGGTTGATTAATTGCTCGAGCCGCTGGCTGCACACTTGCAGGTAGCGCTTCACGGAGTCTTCTTGGCCGTTTTCAAACTCTTCGAGAGCGAGCTCGGT
CTCCTCAGTCCAGTAGATTTGCGTCGAGTTGAGCACGACCTGAGC