Description :
From Genome Similarity Track
Location :
Scaffold_288:34711- 36967
Transcript NameFunction/comments
Hyaar_Emoy2813532ryanodineinositol 1 putative

Sequence
2256 bases(100 bases per row)
CGTTGCGACAAGTTAACAACGTACCGGGTCATCGAGGACAGCACGACAGTGTGCACGAATCTCAGCAACATTCTGAATCTGTCTCCATCCCCTCTCTTCT
ACGATTTGCAGCGGCGTTTTTCTGGTCTCATTTTCGTAAAACATCAACTCTAGTACATCCTTGGCAATTTTGCCCGATATAGTGCCGTCCAGGATCAGAT
CAATGAGAGAACCAAGCTCCGTGGCTTCCACCGGACTGCTGACAGCGTTGCCGTTAGATGCATTCAAATGTCCAAACAAATCGTTCAGCACCCAATTCGC
AACCATCTTCGAAGGTCGCGACTTCTGTGCTGCAACGGACTCGAAGTAGCGTGCTGCACCAGGTTCGTTCACCAGTACCGAACTTTCGTAAGATGTGAGT
CCGTACTGGGCGCGCAGTCGGCTTTCAAGTGCTTCAGGAAGTTCCGGCATGTTTCTTCTAATTTCCTCGATAACTTCTTTTGTAAAAACGAGCGGAGGCA
GATCCGGATCGGGAAAGAAACGATAGTCTTTTGCCCCCTCTTTTGATCGCATGCGTCTCTATGAGTAGTTATATCAACACCAATACAAACACCACAAGTC
AGCCCGAATGAGAAGGTCACGCATGTCAACCGTGTCCACGTACAGTTTCTCCAGTAGAGGCATCAAAGGAGCGCGTCTCACGATGTACCTCTCCACCTTT
ATCTTCGATGAGTGCGACCTGCCGTCTAGCCTCGTATTCGGCTGCACGCATCATGTTGCGAATACTGTTCATGTTCTTCACCTCCACTCTTTCACCAAAA
GGGGCTGCAGTGGCGGACGTCATCGCGCGATGAAGAGTCTCTGCATCAGCGTCCACTCCGAGATGAGTCGGTCGCACGCTCACATTCAAATCACAACGCA
TCGATCCTTCCTCCATATTTCCATCACACACATCCAAATAACGCAGCAAGTGCTGCAGCTGGCGCATCACCTGGCCAGCTTCGAGCGGACTTCGCAAATC
CGGTTCCATCACGATTTCCAACAGCGCCGTACCAGCACGATTCAAGTCCACTACAGTATGCTCCTCCTCTAAGTCGTGGTTACTCTTACCTGCAAAACGA
CATACCCCCATCACAACAGCAGCAATAAAGAAACAAGAATATCAGCATCTGCCCCGCCTCACAACTACCCATAGGCCACATTCCGCACAAACTCAAACCT
GAATCCTGCTCCAGCTGAATACGACAAATCCGTACCCTTCTCGAAATCACATCCTACATTTCCAAAATACAACACCAACATAAAAACGACAAACCGGGTC
ACCACCACCCACTCACACAAAGTCCAGCACAACAACCTCACAGTATGCAAATAACACGTGAAAAGCTCAACTTTTCGATAAAATCCTTCATTCCTCCGCA
CCTGTTGCTTGCTCAGCTGCTTTGTCTTCCATCTTGCCCGCGCCTCGTTCTTCTCCTTCCTCGACTTGAACTTGGACGCATCAAACGTCGTCTCACTTGA
CGCCCACGCGCCTCCGTGTTCACTCACGACATTCGACAGCGCGACATCAAAGCGCAACGCGCCTCCAGACGCCACGGGCGCTCGCTGCTGCGTCAATTGA
TAGCCCAGCGGCAGGTCGCAGTAGAAATAGTGTTTACGCTCAAATAGAGAGCGCAAATGAACAGTGGCGTCCAGTGCAAGAGCTGTGCGAATCGCTTGAT
GGACACACTCGCGGTTAATTACCGGTAATGTACCAGGTACCGCAGCGTCCAAGAAACTGACGTGGCGATTGGGTCGCACCGACGAGAGCGTGGCCGCTGC
AGAGCCGCTCATGAGTTTTGAGCGACTGAGCACCTGTGCATGCACCTCCAAGCCAATGCAGACCTCCCAGAGCTTGCCACGAGGGCCGCGTAGCAGCTGC
AGCAGTGGCTGGTGTTGAGCCATGATCGAGGTCGGGCACGGACGTCGTTGATTGGTTAGAAGTGGGCGTTTGTTTGTGGGTGATACGGATCGATTGCGTC
GATGCGATGGTGTTAGGGCGCTGTAATTCGATTTGTATATCTATTTTTGTTACGGTGAGACGGTAAGGGGACTGTATTGCGGTCTGCTCTAATCCACTAC
GATTCGGGTAACGGCGAGGCATCCGCAAGTATTAATGTGTTATTTCAGTAACGGTCCTATCATAACAAGATCGACCGCTGAATCCCGAATGCTCCGGCAC
GGTATCTAGGCCTTCGCAAGGTAAGGTAAGACACCCTTCGTTACCCGGTAAAACGG