Description :
From Genome Similarity Track
Location :
contig_36:347047- 351689
Transcript NameFunction/comments
g7489.t1hypothetical protein

Sequence
4642 bases(100 bases per row)
TCAAATGCGGAGCTGGTCTGTGGGGCTGATGCCTGTCCAGCCCGTCATCTCCGTGTCAGCGAGACGGAAGTCGCCGTCCATTTCGACGCAATTGCGGACG
GCGTACAGTAGTTTTTCGCGACAGATCTCATCGCTCGAGTATCGAGGCAGTTGCAGTGCAAAGAAGCACGTGTGCGACTTGGGCATTTGCGAGTCCATCC
ACCCGCCAGAGGTTGACGCCGCTCCGCTTGACGAACTGCTGTCTCCAGTCCCCGAAGACGCAAGAGCTTGGATTTGAACTTCTGTGGAACTGAGCGGAGC
CCAGAGGGCAGACGCGATCGGGCCCACACGAACCGCAAGAACGCACGCTTGTCTTCGGACTCGAGGCCTTCGAGCACTCGCCAGAAGCGCTGAATGAAGT
CGTCAGTAGCTGAGAGCTCTTCGTCGTATTCCGTGTTGGCCTGGAGGAGCTTCACGTCCACCTCTGCGACGCCACACATGCGTTTCTCCAGCTCAGTCCA
CGTCAAGAGAGCTAACGCTGAGATCGGCATGATCGAGTGCAGCCCCTGCTTGACGATGTTCATCACCTTGTGTGTCTCTTGAACGCGAGCTCGCAGCATA
GCGTCCAGGTATTTCTCCAGATTGGCCAAGGTGACAGCAGTGTTGGTGCCGTCTTCGCACACTCGACGGTGCGTCCATCGGACAGCACAGTCGTGAAGAC
CAAGTCCATGGCTTCCAGCTGCTCTTCCAACTGACGACGTTTTGTCGATGCTGTAGCCTGAAGACGTTGAGATCGTCCAAAATGCCTCGCAGCGTCTTCC
AGAGCGAGAACGCGACAAAATCGATCTCTTTCAGCGTCTCCAGTGCGTTCTCCGGGTTTGAATCATCCTCGCCCACGAGCTGTTTCCACACCGACATTGC
CAGATCGAGGCGCACACAGACTCGAGTTCGTAGGCAAGTCCCAATCATCTGACCAAGGAAGTAGAACATCTCGCAGTAGAGCTGACGCTTCTCTTCTGCG
CTTTCTCCTGCTGAAGAACGCACCCTCGCTGATGGTTTACCAGCATCTCCAGCGTGACGAGTGATTAGCGCACCATTCAGTACAAACTTTTCTCGGCTCG
CTCCAACGCCGTTCCGCCAGTTTGGACTAGGCATGAGGAACGGTAAAACACACTCCGAAACAGCCACGCCTGCCTCCAATTTCAACGACGTGCTACTGGG
TCCTCCGTTCACTGAGCTGTCCGCATTGTTTTCGGAGTGGGTTCCGCCTTCCGGTACGTGCAGCATCTGCAACTCGGCGAAGAACTGCGAGAAGAACTCT
CGGTACGGACCACCGTAGTCATCGACGCCTTCTCCCTCGAACTTGACCTTAAAGCTGCGCAACTGGCCGTCATCCATCGGGTGCGAGTACACCATGCGCT
GCGTCTTAACTGGCAAGAAGTGGAGCTCTTCAAACGCCTGACCAAAGAGCGACAAGAAGAGCTGCTGATGGTCCCCTCGGCATTTCGCCGCTGCAGCTTT
CAGGCGGTTAACCTGCAGCTGTGGTAGATCTTCAGGGTAGTCGTACTCGTCATCCGCTCTCTTGGGCGAATTCGCCGTCCTCTCCATCAAAGCCGTGAAG
AGAGCATTTTTCACGCAGACAAAGAGACTCCCGCGACACTGAGAGATCAGGCGACAGGCAACGAGGTCGAGGTCCGCAAGAAGTAGTGCCACGTGAGATC
AAAGAACGGCAAGGCACGGCTCACGTACATGTTGGAGTAGCGCAGCAGGGCAAAGCGTGCAGTCACCATTTTGTCGCGCTTCTCCTGCGGCAGTGCAAGC
ACACTCGCCACGGACGTAAGCTCCAAGGCGGGCGTTTTCTCCTTGACGAGATTGACAAGCTGAGTGGTGTCAGATTCCAGGGACTCGTTTGTGAGACCTC
GCAGAAGTCGTTGATAACACTCAGCAGGTCTCTATCCACCGTGAGGCTCCAAAGTACATGCTCACCATACTCAACGAGCTCTTCTTGTGAAAGCACAAAC
GATGATACTTCCGCTTGAATGGTGCTGTCAGATGTCACGGAGCTCGAATCAATACGCGGCGGTAGTGGGCTTACTACAGACTCCGCGGGAGGTGTGGGCA
ATGTACTCGTCGTCGAGCTGGCCATTGTCACTAGCCGCACTTTTGACGGATGGAAAAACCACGCTCCAGGCTCGTTGTCCACTTCGACCCACATTCTTCC
AGCTGCAGCGCCCACGACAAGCCATTACCACGGGGCGTCCGAACCCGGTCGTTAGCGTAAAACCCAAGCTTGCCACACGTCTCTCGGGTGACGTCCACCC
ACAGCGACTTGCCCGATCGCGTAGCTACAAACTTTGTCGACCCAGCGAGCCATTCGGTGGTCATTTTGGACACTGCAGCGCACATCGCGGGACGCAACGG
CTTGTTTGCCACCCAGTTGGCCATGATCTCACAAGCGACCAAACAGTCCTCGACACTGGCGCTGGCGTCTTCACCCGTTGAAGACATGTGGCTGCTGACA
CAACTGTCTTTTGCGAAGGAGATCTTCTGGTGGCGCGAGTAGAACGCAACGGCAGGACACACTTCTCCAGCGATGTTGTCGAATGCCAGCCCGAGATCCA
CGCCATTCTTACTGAAAGACAGCTCGCCCTTCTCACAGTCTAAGCGCAAACCAATGCAGTCGCCTTCGGTGAAGGTCTCGCCATACGCTCGCACTCGGTT
GCGTTGGTAGTACAGTGCCTTGTCGCCGATGAACCCCCACGACTGATCATCAGCTCCAAGAAACGAATCGAGGTTGGCTTGTCGAGTTGCAACACCAACG
AAAAGGTAGGGAGAGCTGGACTTCTCGATGCGAACCACCCATGAATGAACTCCCGTGGAGAACCCCACGCCAGCGCACGCTGCCTTCCAGACTTCATTGC
CCGAGTATGACACACTCAAACCATCTCTGCAAACGCCAGCAAACTGCTTCGGCTCCTTTTACGATCAAAGTGCAGCGAACTACCCTCAAGTTTCGGGTGA
ATCGGAGCGGTAGGAGGTGGCTGGGAGGAATAATCGCCACTTCCACCAGCGTCCTGTGTTAAACACCGGGCCACTGCAAGATCACTGAATCCCGTGCAGC
GTTGCAGAACATGGAGGAGCTCCACGTATCCTTGGAGATACTGCGAGAAAAGGAGGCGTCCTTGAACCAGTTCTCGACTGTGCCGCAGAATTGCTGCTGT
CAAAAACTCCCCGACAACCAGTTGCGCCTCGTTTACTATCTCGGACGCTTGGCCGACACTGCCTTCACTAGGAAGGGTAGACAGCAGTCTGCTGACCGTC
CGCAGCACTACAAACTTCAACGGGAGATTCGTCGTGCCGAGACAACCTCGCAGTCGACGTAGGATAGTCGTGGTAAACCCAGCAGAAAGAGATAATAAAG
TACTTCTCGTGGCCCCTGCCAGCAGAGCGTCCAGTATCCAGATAACTGTTTCGATTCCAGGTTCCTCCGCCACAGTCTTGTCCGGGTCGTTTGAGGTCTC
TCTGAGTCCACAGAACAGCTTCGTACCTCTTGCTCGATGCGGCAGCCTCCAGCTCGCTAAGACAAAGCTCTAAGGCGTCTGGCACGAAGCGGCCTGCGTC
CTGATCCACAAAACACTCAAACGCTTTTGAAAACACTTCATCAACCGAAACCTCTTTGAGCTGCGGGGTCTTGTTGCTCCTCGAAATGACTGTAAATTGG
TCACCGCGCAGTAGAACCAGCTTCAGTAGCTTGAACCATTGAGCGTACGAGATCGTTAACCGAGCGATCGAGCCCGTGGTTTGATGCAGTAACGTCATCA
TGCACTGACGGGCATAAAGAATGGATAACGTTCTCTCAAACGTTCGCAGTTGCTCAAGAAGTCCTCTGAGATCAAGTTGATTGAGTTCTGCCTGGAAATC
CTCTTCAAATGGAGATCGTGACGTCTCAGGTGTGTTGTCAGCAATAGGTTGCGGAGAAGACGGCGCAGTCCTCGCTTTCATTTCGATTGCCTCAGCTCTC
CACGAGCGCATGAACCGCGTCTTGGTATTTGAAAGGTAGCCTCCATCTTCGAAAGGGAAGTACATTTCCCCAAACAGTTTCCGGCCCATTTCCTTGTCAT
TCAACGGTGGCACAGTGACGCTATCTCCTTCCTGCACATTGAAACTTGATACCACAGCCTTCGTAGGCGAGTCGCTGCTAGTGTGAGTGTCGTCCTTTGC
GAGTTCCGAGTCGTTTTCACTCCAGACGGTGGCCTGCAGCCAACTGTTGGAAGAATTCAACGGTGGAGGCTGAGTAGAGGCATTTGCTGTATCGTCACAA
GGCACAACATCGTCTTCTTCTTCGTCGAAGCGAGGTGAATCTCGTCCTTTGTCCCGCTCCTTGTCTAGCGTAGACTGCAGCTTGCTCAGATACTCTAGGT
TGTCAACGATCCAGGCTGATGCACTCACGATGTCATTTTCTGTTTGCTTCAACGCCAAGACACACCAATCTTCTGGGAATCCCATCAGCATAAGCTCTTC
GACGAATTCGGCTCGGGTCTCCTCTGCGTCGTCGTCATCTTCGTCGTCATTGTCAGCATCGTCCAGGCTTCCCTCATCGTCTTCGTCTTCATCATCGTCA
TCCTCATCATCGCCATCTTCGTCATCGTCATCATCCTGGGCA