Description :
From Genome Similarity Track
Location :
Scaffold_290:3470- 7032
Sequence
3562 bases(100 bases per row)
GAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAGACCGGCCGACTTAAACAGCCAAGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTC
CCACTAGCAGGTTGTAATTGAGATCCAACACGAGCAGGAGCGCGAGTATCTCCTTCTCCACCGCTCCGTAGTTCAGTTCATTTGGCTTTAGCGTCCGGCT
AACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAAAGCTGCTGAGACCGCCCAGTCACTGGAATAAACTATCACCGTAGGTTGACGTTCC
GGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGT
TCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGG
ATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTTATCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTAAT
ACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGA
CAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAGCCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTC
TTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCGCGATTTCGCCGGGATTAGAATGT
CGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGGATCC
ACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAGCGAGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGTATCCGG
TTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAACCCGCTGGCCATGTCAAGAGAGC
GGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCACCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAAT
GCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCC
TTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTC
CGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGC
CCCTGGATCCACTTGGATATCATCAATCGTGACCTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGA
TCCCCGCCTTCACGGTAGCAGACTTGCTCATCTTCCGTCTTCGTAGGGTCCACCATTGGATCCAAACACCGCGACCCTCTTTCGCCTGGCAGTCCTTCTG
TCTTCGGGGGATCAGATACCCTGGGTATCAGGGAAACCACCAGTTGGATCTAGTCGGTCCTCTAACGAGCTTAAACCCGACGGTTCTGGTTTGACTAGTG
TTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAAAGCTTGGATCCAGTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAACCCTCTGCA
ATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATTGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGAAC
CCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCG
GTAGTCGCCTCGTACACCAGATTCTGCCATACTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATC
GTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCTGGATTACGATCGGCAC
CCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACCTTAACCGATCTGGCAGTTCCCAGGTTTCACCGGGCTCGATCCAGGTTGTCTCA
TCTGCCCTTATGATCCTCATCTTCGTTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGAT
CCAGCCTCACTCCGGCCGGTACCATGAAATACATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACACCAAACAACC
TGCCAGCGTGATCTTGATCCGCGTTCTCCCGTTTGTACGGTATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCA
ACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTT
GTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGT
AACCTGACAAACCTCGGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCC
CTTTGTAGATCTAGGGTTGAGGAGACTTCGGATCTGGCAGACTCATCCAATTGGCGCAAACTAGAAATCTTGGCAACTGACACTTCATGTAGATCACGTG
TATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATT
CAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCACTGGCGGATCTGATTGTAGA
ATTCCTCCATCGGACAATTGCCGACGTCATGAATCTCGCCACAGCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTTAC
ACAGACCAGATGTTTCCACCATCCAGACTCTGTGTGCTTCCGGGATCCGCACTGCGAGCATG