Description :
From Genome Similarity Track
Location :
Scaffold_837:3470- 5790
Transcript NameFunction/comments
Phyke_g11171hypothetical protein

Sequence
2320 bases(100 bases per row)
ggGAGCCATGTCGCGTATGCAGTATACAAGACGCCACTGGTCGAAGGTTCAAGTCCGACGTTGGCGATGTGGAGCGAAACGCATGTAAAAAAGACACTGG
TTGTGAACAAACAAGATGTATTGAAGTTAACGACGGCGACTACAACATGCGAGCGGCTGCGACGACTCAGGTCTCCTCGATGAACTTACCCTCGAGACGC
GAAAGAGAGTAGGCCGGGTGAGCACGCGTCACGGTGCAGCGCTGATGGGCGTCCAACGGAGACCGGAAGAACCGACGCCAGGGTTCACGCGCGTCCAGGT
CTTCCAACGCGGCTTGCAGAGACTGGTGCTCGTTGCCAGGATACCAACGACCCCGATCAGTACGCGGtggtggaaaatgaagaaacAACGGGTCAAGAAG
CAAGTCCATGTCGGCCAAACCGTGACGGAATAACGCCAACGCAAGCTGCAACACACTCGCCAAGTAATCACCGGCATGCGACCGACGTGAGTTTCGACGA
CGGCGCCAGGCGTCCCAGGTCGGGCCGCTGGGCAACATCAAGTCGTGGGACGATTCCCAATACGCTTGTGCCCAATGGCTCAGGTGCGTCTCATAGCGCG
CCAAGAGTGTCTGGAACGAGGCATCCCCATCGGTGAACGTGAGCGGTGTCGCCCGCTGTTCCAAGTAGGCCCACGGCTGAGTCGCGTAAAGCGCCTCCAC
GTTGGCGCGCGTCACAAGACCGGAATTCCAGGACGCCGGCACTGGAGGCGCCGAAGATGGAAATATCCAGAGCGGGAGCGGCATGTATAATCGTCGGGTT
ACAGGAACTGAGATGGACCCCAGGGTTAGCGACCTAATCGACGCCGGCCATGGTGCATAACTGTCATGTTCCCACTCCGATCGGTCACGGACCGGAGGAA
TCACCGGCGAGAAGGATGGTGTTGCCACGGCTTCATCGCCAGAGCTCGACGGGGCAGGTGACAAGCCTGACGCTGGTGAAGACGggttcgacgacgacga
caatgacgacgatgacgatgaaatcTGACGCGCGCGACGCGAACGCGCTAGCACGACGCTGTCGGAAGACCTGTCAGAATCACTGCTCCGAAGCCTACGC
TGTGGGGTAACCGTAGACGCTGACCCGGCGGAGGAATGACGGGCACTGACGGCTGCGACACTGTCCGACGCAGCAGTGTCGGCCTTGGTTGACGACCGGG
AACTACGACGAGGGgttgctggagaagacgcgGCCACCGATCCATGCACGGAACTAGAAGGGCGAGAACGCGTCGGCGAAGATCGGGCGGAACGCGAAAC
TCGGGTAGCGGTACGCGATACGGAAGACGCCCTCGATGTGGGTTGGGCGCGCGACGCGCGTCTTGCCGACGACGGGAAAGTCGGGGTCGACGTCGtagct
ggagaagaaggagcaacGCCCGACGCAGGTATGCTGGTGGTCGACGCAGCCGCTGGAGATGCGGACACGCCCAGACCTGGGGCCGTATACGCCGACGGCG
ACGCTGATGTTGGAGTAGTAGACGCCGACGTgactggagaagcagacgGGATCGAAGATGGAGTTGTCGACCTTGCCGGTGGAACAGGGGTCGCGCCAAC
AGAAGACGTGCCCATCCCTGACGCTTGAGCGGGGTCGTCGGGAGGCAACGGGACCGCGGTGTTGACGGCGATCTCCATGTCTGCCTCCAAGGAACGAGTT
AAACCCGCAATGTCCAGAGTACCACCGACTTGCACCACAGCGGAAACAAGTCGGGCGGCCAAGGCATCACGAGTACGGCGAGCAACCTCACGGCCCAAGC
GGGCATCGCGAAGCAGACGGCGCCATGCGACGGCCCGTTCTTCACGTTCACGCTCCAAACGCGCGAGCTGCTCCCCCAAGTCGTGAACGAGCACGTTTAG
CTGATGGCTGCGTGCGTCGGACTCTCGCTGACGCGCTGCAGAAGCCCGACGTGCGTTCACCAAGTCTGCGCGATAATGGTTGACGCGAGACgacgcctcc
agctcctcagcTTGAGCCCGGCCGAGATCGGACTGCGCAGTTATCCGCGCAGACTCCGCCGCAGACACGGAGGCCTCCAAGGACCGGATACGCGTTACGT
CTCGTTGATGCTCCTCGGCATGCGCGACCAGCAAAGCATTCACACGTCGGAGATCCGTCTGGAGTGGCAGGTTGAGAGCCTCGGCCGACGTGGTCCCCTG
ACGGCTCTGCGAGAGGGCTTGTCGAGCCACGCACAATTCAGCGGTCACCGCGGTACAACGTCGGACGTGGGCTGCGGAGTCACGGAGTGCTTGATCGCAT
TTCACATGAGCCGTCGAGAG