Description :
From Genome Similarity Track
Location :
Scaffold_771:3470- 4713
Sequence
1243 bases(100 bases per row)
GCTGAAGGCTCAGGCGATTGGTCCATTTGTCATCGAGTTCATGGTGAATGAGAATGTCGCTCGGCTGAAACTGCCTCGCCAACTACGGCGCCTGCATCCA
TCCTTCAATGTCGAAGTCCTTGAGCCGTACCCTGAACAGCATGGCCGCTTCAATACGCGACTGCGACCCAAGAAGACACCTGTTGAGCTTGCGGACGATG
TTGCTGACGCGCGCCAAGCGCACATCAACGGCGGGGGAATGTCAGCTTCACCGAGCAACTGTGCACCGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCCCATAGCCACGTCACTCGTGAGCACCATCACCTCGCGTGAGTGGCAGCCA
TTATCGCCGCGGCCTCCGCGGCCATGATGGCGAGGCCTTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTGGTACCTGGGGACCACCGAGATTGAGGCAAGTCCAAGTGGCAGTGGTGGCCACACTCGCCNNNNNNNNNNTCGGGCCACATAGGA
AGCGAGGTTTAATCCACGCACCGTTGACTCGTGCCGACGCTAGTAGGGCGAGACTCGCTTGCTGCTGGGCAACGAAGGTGCTCGCCGGCACTCCATTGAC
TAAAAGTATACCTGCACCGTCGGGATCTCGGATGGCCTGCACATCCCGTCTCTCGTGGTCGTTTACAAGCCAAATGTTGTTCGAATGGGATGACCTGCTC
AAGGTGGCGGGAAAGTTGCCCACGATGGCGCTGCAGAGTTCCC