Description :
From Genome Similarity Track
Location :
Scaffold_1925:347- 1634
Transcript NameFunction/comments
Pytir_DAOMBR486snap_masked-pir_contig_1925-abinit-gene-0.5HECT ubiquitin ligase

Sequence
1287 bases(100 bases per row)
CAAGAAATCAATCGGAGGCGGTTGAACTGTGCAACTTCGTTTCCAACAACCAACCAACCCCCGTTGCGACGCAATTGCCGAGTTGCCGTGGGGGACTGTG
TAGGAGGACTGCTCAGTAAGTATCTCCTTCAGCGGAACATCCGAACTTGCTCTCCCATAATCTAATTCACAGAGCTAAGCTTAACATGCTCACTGGGCGA
CGCATTATTCTTCAACCAGAGCATAATCTACAACAACGCGATTTACAAAGGTTCCACAATCAAAGTAACGGAACTACTCTGTAGTAAACTCGTACAAGTC
CAGGTCCAGCACTCCGTACAGCACGACCTTCAGCTTCTCGCGCGACTCGTACAGCGGCAGCCCCAACCGGTTGAAGCACGCGTGGCTCCAGATGTACTCG
CTCTCCTCCAGCTTCACACCATGCAACGCAAACAAACTCAACTGACCGTCGAAACTCGTCAGCGCACTGAAACCCGTCAGCGGCACGCGAGACGACCCCG
TCGCGAAGTGCAGCAACCGCCGACGGTACTCGTTCGGCATCTCCCGCACTAGCTCCCAGAACCACCGGAGCGCGTCGTGGCAGCGCAGATCGTCCGTGAC
CGTCGTGTGCCTCTCCCAGTCGTCCACGTCGATCTCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCTCGAACAGCAGATAGC
GAAAGCGCAGGTCCAGGTACGCGAGTTTGTTGTCGTCCGTCACGTCCACGTCGCGGCCATTCTCCGTCAGGTCCACTACCTGTACGTTACACTTACTGGT
GCTGGTGTCACTCTCAGTCTCGCTATCACCACAACTCTCACCCGCAGCCTCAGCGCTTGACGGAGTCTTGTGTACAATGGCGCCTGCTTCTTGCTGCGGC
GCCGCGGATCTGACAGCCACTTGTGTGGTAGGATAGGCTTCGTCAACTCATCATCCTAGTTGAAGTTGCGCTGAGGTGTTCGCATTGTGGTCCTGTTTTA
GCGATAAAACAGTGGTTTTATTGCTTGAAAGAAAATCCAGTGATTTATCGCTAAAGCTCTTGCTTCTAGACAGAAATCAACGATGTGGAATGTTTCTATC
AATGTTTCACATACAGTATTTGTCGCTAAAAACCGGTTGAAAAACCCAAATGCTCCACATTATATAAATAATACCCTTGTGACAATAAAAAAGCAGCTCG
ATATTCGTGACTCAACTTCTTCATGTTCCTTTCTTAGCTGATACATCTGTGCAGTGTCATACCTTGTTTTTTGTGGTCGTCACCTTA