Description :
From Genome Similarity Track
Location :
Scaffold_283:34682- 40641
Transcript NameFunction/comments
Phypl_g6430pyruvate dehydrogenase [lipoamide]
Phypl_g6431conserved hypothetical protein

Sequence
5959 bases(100 bases per row)
CAAAAACGGATGTTAGTAAATCTGCCTGTGAATGACTCCTGGTCATCTCCATCTAACAAAACTTACGGCTGTATTTTAGCTTGCAGAGATTGTGGATTGT
CTTCTGGAGAAGCTTGACTCTCGTGAGGCACCCATTCgcaatgctgcagcatttgcCCTTTTAAAGGTAAAGTGACTAAGCCATCTCCATCGACAATCTC
AACAAATTACGATTGCTTTGTCAATATGTTCGTAGGTCGCTGGATCCACACGCACAAGAGGCACGTTCGTGACGCACCTACTACTAAAACATGTCGAAAG
TAAACACTTTCAGCCGTCagatcagcagcttctggcgtTGTTGAAACTATTGGCAGCGCTGTTGTTGTCATTTCACTGTTGTGCAAGTTTCGATATCGCT
CCTCGGCGAATTCTtcgcttcttgttgctcaGTGATGCAGACCAGCACGAGAACACATTAGTTCGCGACGCGGCCAAACAACTCGTTCTTGCAATCTGCA
ATGATGTGGACGAGGAGTTTGTACGGAAAAATTACATCCAACAGCTTCCACCCGAGCATCAGCGGCGATATGACCTCCCTCTGCGTCGAAAAGCGTGATA
GAAGCTTCTAAACTACCGAAAAATCAAGCGTTTCCTGATAACTCGCTACTGAACTACGCAATTATCGGTATCTTTCCCGGCTTTGCCTTTGGGCTTCTCT
TTGCTTTTAGCCTTTGTCTCACGACTGGGTTTGTTCGTTCTCTTTAGATGTTTTACACTTTCCGGATGCGTGGGAATTTGTTCCATGATGGCTGGAAttg
aagaggaaggaggaTCATCCGCTGGTGGAGTTGTAGCTGGCTGTTGATTCGTAGCGGTAGAGGATCGATTGGCGATCGCAATTTCTGGTATAGGTGTTAA
ACCTCTTGCGTCCTGGACCGGGATCTTTGGAATCTCACTCGGCACCATATTGACGGTGTTAGTGATCACACTAGTGCCAAATTGACTATTTCTCGAAACT
GTTGTAGATtttgaagctggcggagcttGTATGTGTTGCTCGGGGGACACCTTGTTTGATCGTTTCGGTGGATCGCTACGCCGCTCAATTGTACCTCGAA
AAGTAGCAAAATTTGACGCAATTTCTTGGTGGCCTGCGGAGTGAGGCGACTCTAACTTCTTGTCACCAACATCGAACACGAATGGGGCCGATTTTTGTTC
AATTTCCTCGTGGAAGGTCCCTTTTGGTGGTGTTCGGGCGACAACCTCTCCTTGAAAAGCAATGTTGCCTTTTTGGAATGACGCACGAGTCACGAGTAGT
CCTTCGTCCTTGGAGGCGGCTTGACTCGCGCGTACAAACGAATGCCGATAAAGCGCGTGTGGACGAGGTTGGGATACAAAGTATCGCTGGAGTTGTGCGG
TAAATTCCGTCACCTGGGCATCCAGCAGTGGGTCTTGAATAAAGAAAGCAGTATGAGAGTAGCGATGAGAATGGTGGCTCTTGGCGTGGCTCGAGACTTC
CAGATGTCGGCGGACGGAGGTCAACCGGTTGGCGCGTTCATTGTTTTGGTAACTGCTCGAAGCAGATCGATCGATTTCTGCTAAGCACTCCGAAGCAAGG
CGTGTTACAATTGTATCTTCACGGTCCGCTGTCAGTTGGGCACTTTGTGTAGATTTGTTCGAAGGTAATAGACTGGTGCTAAGTGTATGAATACTCGATT
TCACGTTTGCAGGCACCTGGCAGCGAATGATATCGTTGCGAACCACGAGACGAAGCAACCGCAAACGATTTCTTGCAAATGTGAGGCCTGCCGTGTTGCC
GGTAGGAGTTAaatcaagaagctcatcgaAGAACTGTGTGCAAGTTAAATCCTGTTCGACCAGCAAGCGGACAAACTGCAAAAAATCTCTATCGATGGAT
GGTGGAGCTGAAGAAAATCGGCTCAAACCGTTGGGGATCGTCTTAGATGGCATTGTCGATTTACCAGTGTGGTTGATTAACCAGCAAAATGGACTTACAA
GAGTCCACTCCAGAATGACTCGTAGGCCGTAACTCCAGTTGGCACACGTAACTTCGTCAATTAGTCCAAATGCTGAGGCACTTGTACAGTCCGGAAATAT
GCCACGTTCAGATTCCACGAGCTCTGACGCTTTCTTCACGATTGTCATGTCAGTCAGGAATGCGGTGTGTGCTAAATGAATTGCTGCCTGGAACACTTGG
GATGACTTTGCCTCTCGGATGCCAAGAACGGTAAGCGCGACAATACCCTCGAACGCACAGGTTGCGCCAATGGACTTTTTCATGAGAGGAGCAGTACGCT
CGGCCATGTGTAAGCAAGTCAGTTGAATGTCCGCTCCACCGCAGAGCAAACACTGTGTAAAGAACGTTCCAAAGGTGTACAGCGTGATCTCGTTGCTGTT
AGCGGGGTCACTTGGTGAAATCGTGGGAGACTGCCACGAAGATACTTCGTCTGTGAGTTTGCATATCTTTGTGGCCAGGATTTCCTCGAGCGTAGATCTC
TCGAGAGAGGTTTGCTCGACATACTGTCGCAGGATGGTGTCGAAAGGTGACGCTGGATCCCTGTCTTCGCTGCTATTTTCCGGCGGTGCCAATGTGGCAT
TATCAGGAACCGCTGCACCTTCATAGTTTGATTCTGGTGTGACCTCTACAGTGTCATCAATTGCTTGAGATGGCAGCAACATTCCAGCTTCACTGTTTGG
AAGGCTGGCAACCTGTGCTACAAGATCCATCGGCACTCCAGCATCGAGTAGAACCGCCTGCAactcgtcgttgtcgctggTGAGAGAAAGCAGCGTAGGC
CGATGAATCACCCCAGAACGATGGTTCATTaactcctcgtcctcttggACAGGGTGCAGACTCTGAGTAGGAGCCGAAGCTTCAGCAAACCCTAACAGTT
CAATATCGTCTAGCACAACCTGTACCAGTGGCTGTCAGTACGCATTGTGGCTGAAGACGATATTAGACATAGTGCATTCAGTACCTCTTGAGACTGATTC
CGTAGGCTCGCATGCGGTGTGTGGACAACGAGTTTGACAAAAGAACACTCTGGTGCATCCAAGCGAATGGTCCTGGAATCGATATCTCGAGCTGTGTCTA
ACCTTGCTGACGAGCACTCCTCCCATACTAAAGGTTCGCTACAAAGCGCATGAACCACGAAGCTTTAGCATCAATGAATACAATGAGATCTGGAAGAGCT
TCCGACCCACCCACCAGCATTGCTTCCAGTCGACACTAAGATAACGAGATATAGAGTCAAGAGCGCTCAGCGCGTTAATAGATCCTTGTCGTGGCGGTAA
TGCAGCAAACACGACAACTAGGATGACAAACAGCGATTAGAGACGCAACGTGTGTACGATCCAAGTTGCTGTTACCGCCAACTTACTTTTTGCAGGGGCC
CGGGCAACCTCTACGGCCAGACGCAGAGCCTTGATCGTCGCAGGTTGAGCAGATAGTAGAATCAGCCCCAGCTCTTGTGGGAACGGAGTGTTACTGTATC
AAGAAATCGTTAGACGGGCATCGACACTCCTCGAgtgctcgacgctgcggcgcTTACGGTTTGGATTTCCAAAGTGGCTGGTTCTCGGACTCCTCGACGG
CACCAGGTGGCTGCCAACGGTGCCGATCACTTCGAGCAGCGACCTGCAGATCCAAGTCGTTCACAACAAGCAGTCGGAACGGAAGACTGTACATGGCATT
ACTGTAAGACCTCCACTCCATCAACCCGCGAGAAGGAAACGGCTCGTTCAGATTAGACGAGAGGAGTTTGGACTCGTCAGCTCTTAGTGCTCACCAGCCC
GTCCTTAGAAGATACCCCATCCATCGAATCATAGGTCCACACTGCATTTGTCTCCATCCTGCTGCAAGCATTCTGCTTAAAATTCGGAAACAGTCTCGCC
GACGAATTGACCTATTTTACTTGAGCTCCGAGGCGCCGGTGAGGCAGCTCATGTAAATATACGTGTCCACGCCGTGGCCCTCCATGGGCATGATCGCCAA
CTCGCCACCGAAGTACTTGGCGTAGAGCTGCGCGATACGCAGACCGAACGAGTCCGAGAAGTCCAGTCCGCTGGCACGtctctccagcacctccgcGACG
GGGTCGTATCCGCTCGAGGGCGGGGACGTGGCCGTGTGGTAGTAGTTCGACAGTGCGTTGGCTTCCTTGCGGGTCATACCGCCACCCAGGTCCGACACCT
TGACGCACACGCCGTGGGGCCCCCCAGAGATCAACACGTTGACTGGCGGAGGCGTCGACGCCCCCGTcctcttggcggcggcgacgctgttCAGCACGGC
GTTCTTGAACACCTCCGTCAAGATGATCTCAATGTGCTGCGGCACGTAGCGGTAAGTGGCGTCTTGATCGCCGCTGACAACGATCTCGggcagctgctcg
ccgtTGAGGCTCTCCTGCCACAACGGACGCACCTTCTGCACGATGCTCTGTGCGATCTTGACGGGCGACGTCTCGTCGTTGACGATGCCTGTGAAGCCGG
GCGTGGGGGTCTGCGccgcgacgtgctggtccACGAGCATGCGGATGCCGATGCGCGAGTTGTAGAAGTTgtccagcgactcgctgAGGCCCTGCGGCTC
GTACTCGAGCGCCTGGACGGCCTCGGCGATGTTGCCGTGCATGGAGGCGTGCTCCGTGCGgatcttgcgctgcagcgccacgaagtcgcgctcgctcgcg
AGGTTGGCGGGCAGCGGGCAgctcgtgagctgctcgaagctgtccagcagcttctcgcgcaagGACACGATGGGCGAGGCccgcggcagctcgtccggcA
GGTTCTCGAGGTCCACGATGCGGCGCGCGATGCGGATCGGCACctcgcggtgcagcagctgcgcggACGTGACGATGGCGGGCGCGTTCGCCTCGCGCCA
CTTGGCTAACGCCTGCGGGTCGCTCTGCAGCgacgcggcgacggcggggCTCGCGCGCGGCccgcgcttcagcagcgcctgcagcgtgaTGGGCGGCAGC
GGGATGTGGTGCAGGCGGTacacctcggccagcaccttggctCCTGcggacgtggccatggcTGAAAGAAACTTGGGGAATGAAGACGAGCGTAGGAGCT
CCTGAGCTGCTCAAAAGTATATTCTTGTGGGATCGGCTCCGATTGCGCAATTTGGGTTTGCGACCAATGGGAGAAGCGTGTTTCGCgtttcagccaatca
cagTTTGCGTGTCAACGATCGGTTGAAGTGGGTCATTTATTTTCCCTGGACGACATGGAAGTTAGTTagacttgctgctggccgtcggCGTGGGGTACTA
ATAGGAAGGCTGCGTCGCCGTAGAACTGCGCCACGTAGTCCAGTTTGTCTTTTGCTGCTGGGTCGGCGCCTTTCTCCGCGAGAAGAGCCGCGCACTTGGC
GTTCCCGTGCAGCATCGCGCAGTGCAGAGGCGTCCAGCCGCAGCGATCCACTTGGCGCACGTCcgcgccagcggcgacgagcgtgGATACGGCCGTGCTC
ATGCCTCGACTCGCTGCCCAGTGCAGGGCGGACCGGAGCTCTGCACTGgccaaggagacgctcgcACCGAGCGCCAGAAGCCTCTGCACGACGTCGATGT
GGCCGTTGGCCGCTGCGCACATGAGCGGGGTCCAgccgtggccgtcgcggGCGTTGATGTCCAGTCTTGGGCTTGTGCTCTCGCCATTGGCGTCGTTCTG
tggccgcggcgtcgtcatGTCAACGAGGAGATTGAGCACTTCGAGTTTACCGAAGTCGGCGGCGTAATGCAGCGCGGACCAGCCTGACGCGTCTCCGGCG
TTCGGGTTGCAGCCCCGACTGATCCATTCTCGCACGAGCTCGGTATGGCCTCGACCACACGCCAGGCGCAGCTCTTGTCCGTATTTGCATGCCGGAGCGT
ACACTAGCGCGAACACGTTTAGTAATTCTACTCGGGATACGAGGTCAGCTGACGGAGTA