Description :
From Genome Similarity Track
Location :
Scaffold_4:346736- 348807
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002061Protein of unknown function

Sequence
2071 bases(100 bases per row)
TGCTGCTTGGCGTAACTGATGTGTGGTCAGCTATTCGAAAAGAGTGCGCGCAGAAAGCAGTCAGCCTCGTGTTCATGCTGCCAGCCATGGAAGCCATTGA
TACGTTCATCGAGCGGCTTCTGCATGTTGCAGTTGGCTCGGAGTACGTAAGAACTCAAGACACAACTCGTCTAACACAATGGAGGGAGCGCGACGGAGCT
CTGTACACTCTTTCGCTCATTCTTAAATCCATCGAGATTGACGAAAGCTCGCGCAACCTGGGTCGTACGAACGACTTGAGTGCTATTTTAGCGACACGGG
TAGCAAGCGATATCAAAGGATTTTGTGGACCAGAGTCAACAACTACTTTCCAGTTTGGAGCCCGCCATACCAACGTCGCCCGCCTACCGCGCTCACTAGC
GCAAACATTGAAGCCTGTATTGTATCAATGCTTGCGGCATGACCAGTTGTCGGTGCGAGAAAATGCTGCCCAGTGTCTGAAACAGTACGTCGGTCTATGC
GAGGAGCCCATGCGCTTGGCAATCTTCCAGGAAGTCATCAGCAAGCTGAATCGAATGAAGGAAAGCCACGATGATAACAGTTCTGCGGAACAAGAATTGC
TCGAGACATATGAAGCCGAAGGGTTACTGGCTGTGCTTGGAAAGCTGGTACCGTCCCTCCCGTCGCAGTTTCTACTCAAACATTGGAAATTTATTTTCCC
AACTCTAGAGAAGTACGTTATGCATATCTCATCAAATGTCCGGCAAAAGAGCAGTGCAGTAGTCCTGTCGCTGGCCAAACTCACTCGAAAGCGCTCCTGT
GACGGCAAGGACCGATCTTCTGACGCGGCTGTGGAGCTTCTTTTGGAGATGCTACTTAGTTTGAGTGAGCAACCCCACGACAGCAACAATTTCTGCTGGC
AGCAGAAAGAAGGAAGACTGCTGAGCATCGATCTACTTGTCGACTTCTTGGGAAAGGACCTTTTGCTCGGCAAATATGGAACGAAGTTGCTGAATTCAGT
CACTCAGCAGCACGAATTAAGGAAAGAGTCGCGGAACTTTGATGAACAAGAGGATCAATGGGCGAATGCTTGCTCTTCCTTGGCTACATGGACAGTCGGT
GATGACGATATGCTCGATTTGAGCGCTTCTTCCGGTGGAGACGTGCACGAAAGTGGCCAGCCCCAAAGTGCTCCATCTCTGGTTGACCTGATTAACGAGT
TTGCGGAAAAGAAGACCAAAAATACAGGGAAATATGTGGCGAGCGAGTTCTGGCAGCGCGTCCTGACAGGTTGGCTCTGTCAAACGCGCCAAGCGTTTAC
ATCAAACCAATTTGAGCTTCGCCGAATTTCGCGTCAGATTCTACCTGGTCTTGTTCGTTTGAGCATATGGCTGAACCAACAAGAGCTCATCGGATTGGAC
GAGGCAAATTTCCAGCAGGTGGATGTTACTTGGTTTTGGTCTTGCTTGAAGTACGTTTTACTTCATCTTCACTTTCGACAAGAGGCACTGGGAACACTGT
CTGCAGTAGACAGCGACGTGTTAGCTCACGAAGCCACACAAGTCGGGCTCAAATGCGCTTGGAAGTTATTGGAGGCATTGGTGACGACGTTCGATTCTTC
TCTTGATGGCTGCGCGACGATTGTTGATACTGAGACGACGGTTGTCATTGTGGAAGTTCAATTGATGGCGTTTTTCATGTTCGCTCAATCGCTTGACAAT
GTGGACTTTATGGTGATGCTTCTGGAGAAAAGCTTGGGCATCGTTCACCGAAATCTTCCTGCAGACATGCAGCTCACTGACCAACGACTACCAAAAACAT
CCAGTGATAGCTCTTTAGATCGCCAGTTGAGCATCTCGCTTGTGCGCATTCTACCAAGTGTTGTGACTGCATTTCGCAGTGTGGTGACTTCTCTTCACGC
AGTGAATGGTCAAGCAAAGCCTGATTTTCTAGGGAATCGATCCGAGAATTGCTGGCGGATTCTGGAGCGCGCAGCTCTCGCCTGGTTAGCCACGGACGAC
ATGTTTCGATGGATTACTGTTGACCCGCGAGAAGCACGCACGCTGTTATTGAAGACTCTTGATCAGCTTCT