Description :
From Genome Similarity Track
Location :
Scaffold_23:34671- 42176
Transcript NameFunction/comments
Phymu_g1495Drug/Metabolite Transporter (DMT) Superfamily
Phymu_g1496hypothetical protein PHYSODRAFT_247505
Phymu_g1497hypothetical protein PHYSODRAFT_492612
Phymu_g1498hypothetical protein PHYSODRAFT_329625

Sequence
7505 bases(100 bases per row)
CGCTACTGTGTGTAGCTGCAGTGCTGATGaccacgtcgtccatggAGGGAGAAGACGCGAAGAAAGACCCAGAAACGACCGATGCTGTGGCTTTTACAGG
GGTGTACCAGGCGCTTCTGGCCGCTGTGCTTTCGGCTTTGGCTGGCACTATTATCCAGAGAGCGTTGCAGAGACAGAAGCGGAACCAGTACATGGTTACT
GTGGAGCTCAGTGTGCTGGGAGAGATGACGCTGTTGACACTGGCCTTCGTGCAGGACGGACTGCTGTCTGTTACGACGAGCACTGGGGACGGGGATTCGC
AGGACAGTATGTGGGAAGGCTGGAGCGTTATGACACTGGCAGCTCTGATGTGTCAAGCGCTGGGTGGAGTTCTAGTGGGTTTTGTGATCCGAGACTGTGG
AAATGTGGAAAAGAGCTTTGCGGTTGTGGGCGGCATGGGACTCACGGCTCTGCTTGAGACGCATTTCAACGGGAAACCTTTTGGTCATAATGCACTCGTG
GCAATGGCTCTTGTGGCGATCAGTACGGCGCTGTACACACTCAACCCGCCTGCAGTAGCAGCTACAGATGAGAAACCTCTGGCGACTCTTGTGCCGACGG
ACGTTGGCATAGCTACTGCGCCAGCTCTTTCGAACGGGAGGTattcgaagaagaaaatgagtGCAGATATTAACGAACTGGAGCCGTTTTTGACGCCGCC
GACTGTCGTCACGGTCAGTAGTAGTCGAGTTCACAAGAGCAGTACTTCTCGACAGGAGATGCGACGGCCAGGACGGCTGTTGCAGCCTCTTAATGAGATC
CCTGTTGCTCGgcaagagctggaagcgatCGTGTAAATAAGTACCATTCCTGATGTATCAACAAACTTACTCTGTATTTCTCAAAATTGATCGGTTTATT
AGCTGAGCTGGACAGCCTGTTGCAGAGACCGTGTGAAGGTAGCACCAGACAACGTATCGAGCTCGTCTGCCTTCCACAGAGCTCCAACATGGCCGTCAGG
ACGCACAAGAGCGGCGGCATTGCTGTCCATAAAGCAACTCCACGCGCTGTTGCTCTCATCGTCAACAACTCCCCATGACATCACAGAACCGAACGACGAC
GATTTCTGAGCCTCTTTGATCACAGTTGAATCGCCGTCAGTACTCGACCGCAGCACGATGAGAGTCACATGCTTCGCCACGGCAAGAGAAaacgagcagg
agctgatAACCTTGGAGGCATCTCGTGCGCTCACGACCAGAACAAACTGCACGTTACCCGCGTCCTCAGCGTTCTCAACTGCTTGACGCATCATGTCGTG
TGTGGATACTTTCACATTCTTGCTGATGCACCAGAAGTGAGGGAATCGCTCACCAACGCGGAACGTTGGGGAGTAAATGACGCCATTTCCATCGCCAACC
TCTGTGCGGAACTCCACAGACTGGTCCAGAGCTGGATCTTGCATGAGTTTTTTGGCACGGGCGGCCCACGATGGAGCATCGTACGAAAAACCAATGTCAA
AATGGTAAAACATCATCCCCAGCGTTTTACGGCGCGTCACGATGTCTTGAACACTGGCGCGCATGCGGTTACCCAAGGCGCTTCCGGCTCCACCAGCATC
CTTTGCTTCATCCAGGAGACCCAGTGGCAGTTTGCCCACGCGCATGATCCGCTGAGCGATTTCCCGTTGTgcgcgaagaggaagaagctgcatgGGCGCC
GAGTTGATGATTTTCGCTAGTGCCAGGGCGTTGTCGTGGGACACGTTCAGCGCTCGTGGGATCTTCATGGTCCGAGCCACGTTACTCAGACTGAACTGCG
TGTTCGTCTTGGCGATAAGCTGACGCTCGCGGCCGTAAGATTTCAGCAAGGTGTGACTGTCGATGACACTCGAAGCAGCCGCGGCCTGATCAGCGTTTGT
CTGGATGGCAAAAGCGAGTTTCCACACCAAGTTGTGGGCATCCTGCAGTCCTGTGTTCATGCCAAACCCTCCAGCGGGAGGGAACTGGTGCGCTGCGTCG
CCCACGAGGAACACGCGCTGATGCCCGGCATCGTACTGCTTTGCGACGCGCGCTCCCATTCTCCACTGTCCAGCTGACAAGATGTTAATATCGTCGTCAC
TGATCTTGGCATTTTTAGGCAGGATATGGCGGACGATCTCCTTGCATTGAGCAGTAGAGAAGTCCCAGGGGATCGACTCCTGCGGAGGGAAGAACGGGAT
CTGGAAGACCCACTCGCCTCGGTTGAGATCGTGGGCAATCAAGATGCCAACGACATCCTTATTGAACTGTCAGAGGCAATTAATAGGTTAGATACTGTCG
TGAACATACCGGCGATGACAAACAGTCCCCCTACCACGAAGTACAGCATAGCCGGATTctcacgtgcagcttctgacAAGGCCTTGCTTGTAAAGTGCAC
GTTGGCAATGCTCTGAAGGTTTCGTGTACCAGCCATCTCGATTCCGCAGAGCTGGCGGACCAGACTATGAGCACCATCCGCTCCCACCACGTAGTCGTAA
GATCCCGTTTCGAGTTTGTTGGTATCCCTGACAACCATCCGAACATGAACATCAATCAGAATTTTAAATGCCAAGCATTCATGCAACTTACAAGTGGCGC
AGCGTCACTTCTGGTGTAGTTGAGCCGTCCGCTGGCAACTTGAGTCCGTCCATCTCCACTCCACGCTCAACCTGCACATCGTTTTCAGCCAGGAACTCAT
CCAGCATCGACTCAAAGCGGTTCTGCGGGAAGTGCAGGAACTGCGTTGGTGACAGCGAAGCCAAAGAACCCCGTAGACTATCAAGAGTAGTCGTTGCTTG
TTCAACCGTATCGCGCGGTATGCCTGCAACAAACCAACGCATCAGCCTCACTTTGTCACCAGTTCCAATCGACTTAGTGTAACTTACAAGGACCAAATTG
GTCAATACGCGCGATCTCTCGAGCCTTGCCCACTCCTGTGCAGTAAACGTAGTCTCGCCACTATCCATACAAATCCGGGTGGTTGTATTCGAGAGTTAGT
TGAAATTCAACTGCGACAATGGACATTTATCTCACGTACCAGTACACTAGGCGCTGCCTGAGCCAGCAGTCGGTCGTGGAACTCAGGCATTGCTGCATAC
AGAACCTCCATCGTCCGCAGGTTGATAAAATGTGCCTGTGGGTGCGACGTGGGGCTGCGTTGGCGCTCCACTACGCGCGTGGGCACATTGTAGAGCTTCT
CAAGCATGAAGGCGGTCGCCAGACCCACGGGCCCGCCGCCTACTACCAGCACGCGCGGCTTCTGGGTCCGCAGCAACTGCGACGTCAACGTCATTGGCAA
GATACACACGAGAGGCGGGGAATGCAGCGACAGCCAGACGCCAGCAATGCTACATGCGCAATTGATACGCGCCGTTATTGCcacttgcagcttcaaaTAG
AGGACTGTTGTGTGGCCCACAATATTTTATACTCGATAAAGTGCGAAGATACTTTTGAGcagagtgattgtcactTCAACCTCATGGACTGCACACGGTT
CCGCgcgctgccgctgcctgtTGCAGTCTCTGCGGACGACGAAGCatccaagaagctgctgaagttaGTGGAGACGTTTAAGGAATATTTTGGACGACCT
CCGGCGGGTGTCGCGCGCTCTCCAGGCCGCGTAAATCTTATTGGGGAGCATGTGGACTACGAAGGCTACGCTGTGTTGCCCATGGCCATCGAACAAAGCG
TTTACGTGGCTTTTGGTGTTGTTATGAGCAACAGTGGTAATGCAGGTTTGATGAGTTTGCATGTGGTCAACGCCCATCCACAATACAAAGCTGTCACGAT
GTCGATCGGCCAAAATGAAGAGGAAATGATGGGGAAACTTGAGCAGGAGCAATCAACATGGGCCAAGTACGTGCTATGTGGAGTGCTGGGGCTGCGTGAC
GATTACCCAGAGTTATTCGAGGGCGAAGCGAAGACGCTACAGATGCTGGTGAATGGAAATATCCCTGCCGGCTGTGGActgtccagctccagtgcgttGG
TCGTGGCTACTGCACTAGCGGCGAGTAgcgcactgcagcaatcAGAACGGGAACTATTGCctcgagaagagctcgctgACCTTTGTCGCAGGGCTGAACA
TCGAGTGGGGACGATGGGGGGAGGAATGGATCAAGCGGTGGCGTGCCTGGCACAACGTGGAGTGGCTCTGCATGTGGATTTTTCAAGCGTTCCTGCCAAG
AGTAACCCAGTAAATGTGCCGGATGCAACCGTTGGAGTTTCTTTTGTCGTTGCCAATAGTATGGTAGTGGCGGAGAAAGCTGTTGATGCAGCTACTCGGT
ACAACAAACGTGTCGTGGAATGCGCTATCGGCGCGAAAATAATGGCGAAGAATGCGGGAATCGACAACTGGAGGAAGGTACTGTAAATGCAGTGTGGCAC
GAGCTTTCGGACGGAAATTCTGTGTATAAGCTAAAAGTGTTTATCAATTAATGATGTTGGCAGATCACTCGCCTCGTAGAGGTCGAGAACGCACTTCAAG
AACGTTCGCAAGAAGTTGTCAGCTTTGGCGAGCTGTACAATCTTGCTATGAGTTCTTGTCCATTGAAGGAATATTCACTTGCTGAAATCGAGGCACAGCT
TGGCGAGCCGATTATCGATCTTTTCACTGGTTCTTTTCTGGAAACCGGCTTAAAGGTTGGAACATGGGTTGCAACTTACTCGTGGCGTTTTGCTGACTTT
TTGTGCATGCAGCTAGTACTCGCGTCTGCAACATCGTTtaagctgcagcagagagTTCTTCACGTGTGGGGTGAAGCTGAACGTGTTAAGCAGTTTCAAA
GAATTTGTGCTTTAGTGGCGACGCTTACATCGGACCACGCATCATTGCAAGAGGAGCTGGTCAATCTTGGAGTCCTCATGAATGGGAGCCACGTTAGTTG
CAAGAGGTTTTACGAGTGCAGCTGCCCGGAACTAGACGACTTGGTCAGTGCTGCTTTATCCGCTGGCGCTTTGGGTGCACGACTGACAGGTGCTGGATGG
GGAGGTTGTATCGTGGCTCTTGTTCGAAAGACCGAAGTGAGAAGGTTTATGGATTCAATTCTGTTAAACTACTACACCAAACGCGGGATACCGACAACTG
AAGCGTTGGGGGCGATGTTCGAATCGGCTCCGGCCTCTGGGGCAGATATTTTCATGGTTGAGCCAAAGTAAATTGTCTTCCCGTTTTTCACAGCGTTAAC
AGTGAGCGAAGCTTCTCCAAATACACGTCTTTTGCCTGCAACTCGACGTCGATAAGTGCAAGCTGCCACAGGGGGCAGAATCAACGTTAGATGGTCAACT
TCGAATACTGCATGTACGATCAATTTGTAAGTGAGCTTACCTCGGCCTTTCGCTGCGCTTTCTCTGCTTTTGTCATCGAAAATTGGAGAATTGTGAAGTC
GCGTTTCATGTCAGACAAAGCCTTCCGTCGTTCGGTGATCTCGTGTTCATACTGCTCAATCTCCTTTCGCATCTACATCGTTTGCATCAATCGCCACCTG
TTCTTAGACTGCGTGGTATAGTTATACGTCTCCATGGCTCAGCAATCTCGTACCTCAACATTTGCAGTGTAGCGATCGATGTCCAAAATGACGCGGAAGT
ACGTGTCGCTCCTCTGTAAAGGGATAACAATACTTAGCACGAGGGTCATCTTAGGCGCATCTCATGGCACGTACATGGATTCTCTCAAACGCCTTTTTGA
CAACTGGTCGAGTCTGGATCCAGCAAGGAGACACCAAAGCAGTATTTTTGCACGGAATCACTCCAATCTCAACCGCATCCTACATTGACATCGCAAAAAT
CAATGTTGGAAAGGGTCACTTGTCACGAAAGTCAAACTAACATACCTTTGGTCGCAAAAACAGCAATTGCTGATCGATCAGCTCCAAGAATTTTTGCTCG
CCTTCGACGCGGTAGTTAAAGGGCAATAACGCTTCCACTGGGCTTACACAGTTGATCGGAACTTTTTTCTTCTCATCCAGAAGTTTCTGAGGTGAACCAA
GATGAGAGCTACCTCCAGTTACTGGAATGACATCCACCAAAGTCTCCAAACACTTCCAGGTTTCCAATGCGCTGAAAGCTTTTGACGTATCCGTAACGTC
AGGTATACGGCCAGAATCGCTTGGTGACGAAGATACAGTTGAGGAAACTGCAGGGGATCCACGAGATAACTGCAGGCTCCCGTCCAGGTGCAATGCTTCC
AGCAACCCTATTTCAGTTTCTTGAACGAAGGCATTACATACTTCCTCGACGATCGCCAGTCGCTCGTCGTGCTCCTCTTCACTTAAATTGGTGTTTTTCA
ATCTCCGGCAAATTTCGTCAATGTCGCTCCACCAATTTCCAGTTGTCTTCAAAATGCATTCAACCTCTGCAGTACGTTTGTCATCGCTCTTTAGTGCGTC
GTCATCACTTGTATCACTAGTGGATTCCTCACACGATTCCTTTGAATCAAGGAATAGGTTTAGGCTATAACGTtcctgcaacagcaaatgTCAGTTCTAT
CGTCAATGGAGCAATCAGGTCATTGCACCGTACCGCTAAAGTGTATAGTTTTTCCTCAGCCGAAGAAGTGTCCACTAGGGTATTTGCAGGACGCAGCAAT
ATACCAATGAACTGCTGAGTGTCCTCCGAGTCTTCACGATGTAAGCCGGTCTGCTGGCGCGACTGGATCCACTGCACCTTGGATGGAGTTACACTCGCGG
TTGTTAGCAATACCACGTATGCTAAGCTTTCAGTTGAGACTTGGTGCGTCCAAAGAAGCCATCTTTCCGCGTCCTGATCGCTAAGCGTGTCAAAATCCCG
CAGCAAGAACACAGGGAGTGTAGTAGATTGCGAACTCGTAGAGGCATATTCCCCCATCTCTTCACCCGCCGTCTCTTTTCGCTGTTCACTATAGTGTAGG
TCTCGTAGCGCATCCAGTAACGCGTCCATCATTGTATCCTCCGAATTGGTTTTCATTCCGACACGCGGGTCAAAATCCTGCGGTACATTGCCATGAAGTG
CAGTCTTTAGGGCTGAATAATGTATCGCAATATTGTGCGCTGCAAGCTGCAAAACTAGTGTTGGTGTCGTCAATCTCTCCAGTGTGTCACGCGTTGATTC
ATCGTACGATCCCAGCACTTTGGCACCTTCCAGTAGACTGCACAGATTCCAGAATATATCGTCAAATACACAACCGCCAAGCCTCACAAGCAGCCAAGTC
ACCTACGTGTTCGTTACAGTTGCAGGGTTATCACCAGCTGATATAGACAACAAATACGGGAATTTTGGTGGTGCACTGCCTAGCCAAGCGGAAGCCCCGG
TCTCATTGGAAGCATTCTGGACCGGTCCGGAGATACTGGACCACTTCCGCAGCTGTTGTTTCGCATACAGGAccttgttgctgtcgtcatattgctgcgc
tgcttcgcCCACTGCTACGGCCACTAGAGGCGTCAGCGTCGCTACTGCAACGCCGATGGATCGAGCGTTGCGCAGCATTTTAATTACATATTAGATGATG
AAGGG