Description :
From Genome Similarity Track
Location :
contig_6:346660- 348737
Transcript NameFunction/comments
g2277.t1hypothetical protein

Sequence
2077 bases(100 bases per row)
CAGATGACACAGGTCGACATCAGCACCGTCATCAACCCCGAAGATAACTCGTTGAACGAGGATTCCGTTCGAACCTACGCGCAGCAGTATGTGGGCTCGT
ACTTGAACACGATTTGGGATGAACCGCTGGGTGACAAGTACGGCTGGACTGCCACCGAATGGCGCGCTGTGGTGTCGCGGATTCAGGAGATCTCCATGGA
GGAGAACGGAGGCCACCCCATTATCTACGGTCTCGACTCGGTGCACGGTGCCAACTACGTGACTGGTGCTGTGATCTTTGGCCAGCAGATCAACAGCGGT
GCTAGTTTCAATCCCGACCTCGTCTACAAAGCGGGCCAGATCACTGCCCGTGACACTCAAGCTGCTGGAATCCCATGGGTGTTCGGACCCATCTTGGAGA
TCTCGCAGAACCCGCTCTGGTCTCGCACCTACGAGACGTTTAGCGAGGACCCCCACTTGGTGACGGTCATGGGCGAGGCGATTATCCGTGGACTGCAGAG
CTACAACCAGACTGCGGCCTGCATGAAGCACTTCATCGGCTACTCCAAGACACCGTCAGGACACGATAGAGACAACGTCATCATGGACGACTTCGACCTG
CTCAACTACTTCCTGCCGCCGTTCAAGGCGGCCATGGACGCCGGTGCCATGTCGACGATGGAGAACTACATCTCCATTAACGGCGAGCCCGTTATCGCGA
GCTCTCGCATTCTGAACGACCTGCTTCGCTCCGACCTGGGATTTGATGGTCTTCCTGGTTTCCGACTGGGCTGAGATCAACAACCTGAAGGACTGGCATC
GTGTCGCTGAAACGTACGAGGATGCTGTCCGCTTGTCGCTCACGCACACGTCGCTCGACATGAGCATGGTACCGAATGACACCGCGTTTATCAACTACAC
GGAAAACATGCTCGAGGGGTACCCTCAGTACGAGACCCGCCTCCGCGAGTCTGCCAAGCGCATCATCAAAACGAAGCTCCAGCTTGGACTTTACGAGAAC
CACATGCCCGGTGCGGAGTTTGAATTCCAGGTCGGCAATGATGAAGACAAGGCGGTGGCGTTGGACTTGGCTCGCGAGTCCATTGTACTTCTGAAGAACA
ATGAAAGTGTGCTGCCCTGGCGAAGGAGGCGTCTGTGTTCCTGACAGGCCACTCGGCTGACAACGTCGGTCACCAATGCGGTGGATGGAGCATCGCATGG
CAGGGATACTCTGGCAACGAGATGTTCCCAACGGTGTCTCGGTTCGTCAGGGCTTGGAGAACTTGGTTGGAAATGACTCCTTTTCCTTCTTCAACGGCCT
CTACGACAATGGCTCGTACTCGGAGGCAGACCTTGCCACAGCAGTTGAGATGGCTCGTCAGCATGAGTACACCATTGCGGTTATCGGTGAGAAGCAGTAC
ACAGAGAAGCCCGGTGACATCGACGACTTGGCTCTCCCTGCTGGTCAGATCGAGTACGTCGAAGCGCTTGCTGCCACCGGTACCAAGGTAATTGTCGTCT
TGTTCGAGGGTCGTCCGCGTCTCCTTGGCTCGCTCCCGGACTCTGCCAGTGCTATCATCGATGGTCTGCTGCCTTGCGAATTGGGTGGACAGGCGATGGC
CGAGATCATTTACGGAGACGTGAACCCGAGTGGAAAGCTCCCGATCACCTACCCGAAGGACCCGGCGAACATCGCCATCCCTTACTATCACCGTGTGAAC
ACGCAGTGCGCCTACGACCACTGCTGGATGGAATGGGACTTCGGTGCCGGACTCAGCTACACGGAATTCAACTACTCTGCTGTGTCTCTGGACACGACGG
CGATCACTAGTGCTGATGCCACCGTCACTGCCACTGTGACCGTCACGAACGTGGGTACCCGTGCGGGTAAGGAGACGGTCATGCTGTTCCTTACGCAGCC
GTTCCGAACGATCTCCGTCCCTGAGGTGAAGATGCTGAAGAAGTTCAAGAAGATTGAACTGCAGCCAGGAGAGTCCCAGGAAGTGTCCTTTGCGCTGACG
GCGTATGATTGGAGCGTGTACGACCCGCAGATCGGCAAGGGGTTGAAGAAGATCACCGAGGACAGCAACTACGTGGT