Description :
From Genome Similarity Track
Location :
Scaffold_4:346657- 353268
Sequence
6611 bases(100 bases per row)
GTTTTGGTAAAAGATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTGTAAGATAGGAATCTGCCAACGGCTGGTTGGCAG
AATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGGTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAA
TGTATGTAGTCTTTGGTGTGTCTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACAGACGTCGTATCTGTTAGAGTTACAAGTGACTGTAGCCACTT
GTGCGTGTAACCCTGTTACACCATTCCCCCCTCAAGGTTAGACGCGCCGAGTTACGGCACGTCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTTG
GGAGAAAGAATACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGACTGCCGCCGCAACAGAGGGTAACCTCTCTGTTGCTCAGTACCATGAGCG
CCAGCAGGCAAAGCGCGACGCGCTCGGTGCAAAGGCCGCGTCGGGGACAACTCAGTCGGAGATAGTCCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTT
GACTATGGGAGTGACGACGTAGAGATGGAAGAGGGCGAGGCCTCTTCCAACAAGCGCAAGGAGTCTATCGACAGTGATAGTCTCGACCCGGCATGCGGGT
CGAGACGCCCTCGTGAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTCGCGCGGCGAGAGCGAAACTCCGCTCTCCGCTGCTGGGGCTTTAAGCTC
CCCGCGTGAGGTGGCGTCTTCAAGTTCTCCGCGCGCTGCTCAGGCAGCGCGCGATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTGGGCAAC
ACCGTGCCTCCAAATGAAATTCCGCTGTACGTATGCAGCGGGATCCACGATGATGCTGTGGCGGAGGAGCAGCACTTTGATCCGTTAACGAATTAAAGGC
GCGATTACTATATCGGACTCTTTCATGAGCTCCGATACTTCTCCAGCAAGAAGACCTCTTCTCGCAGCAAAGTGCATGAGTGGCAGGCACTTTGTCAAAG
TTGGAACGCTTTTGTTGAGAACTTCAACAAGAAGCCGGCTGCTTACAGTGAGCGGGTTAAGCATGCCCGTGAGCACTTCGAGACATTCTCGACGCGCGGG
AGGCTGGAGCAGCTCCATAGATCTTCTGTGGACGCTGGTATTCCATGCGCTGTGCCCGAAGGCCATCAGTGCGCGTTGTGGCTTCCGGGTGCGGCGCGCT
TGAGCGACCGCGACGTAAACGGGTACACGACGATTCGTGTACCTGCGAGTCTCAAGGATCTCCGTGCCAAGTTCTTGGCACGTGAGGAACGCGACGATCG
TGGGGCCTCGGGCGCTGTAAGTGACCACAGCGCTCGCACTACCTTCGCGTCGGCAGTGCGTGGTGAGCTTCGTACTCCCTCACCATTTCCGGAACGTCCT
GCAGCAGGACGTCCTGTGGCTCCCATGTATCTTGGTGGGGCGAAAAGCCTCTCCAACGAATACGATAACGAACCGGCTGCCGGTTCGTTTTCGGGATACT
ATGTTTCACAATACGCTCAACAATCCAGCGTGTTGAGCCGCGGGCATCGCGGATCGAAGGCGGCGGTGGTGGGAACACGCCCCGGGTATGGTCAACCTAG
GGTTGACCTTGGCCCGACGCTCGAGGAGCGGGTCGCTGCTGTGGAACAGCATCAGAGCCGGGAGTTCGCCGCTCTAAAGCAGGAGGTGGCGATCCTGAGG
GCTCAAGTCGCTCAGGCCACGCAGACCGCGTCTGACATCTCTGTCGACGTGGGAGGTCGCGGCGCACGCTTGGCCCAGCGCGTTCACGCGCTGAAGCAGC
GGTTCGATCCCGCTGGGGCTTCCGCTTCGGGCCAGCCGAGCTAGGTGGCTCGTGCTGCCGGTATGGCTTCAGTCGCCCGACGTAAAAGGTCGGATGGAGG
CGCATGCTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTGCCAACACCGAGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGACCCAAAGT
CGGAAACGGCATGTTTAGGCAGGTTTTGAGTTGCTAACAAAACCAATGAACCCTTTTTGAATTCATTAGTGTTGCCCCTACCAACATTGTCAGCGTTCAG
CTTCTGTCGACCGACAGAAGCTGCGATAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCACGAAGATGATTGCGTCCGAGCTGAACGAGTTC
AGCTCGTTTCAAGCAGTAGACCCGGCCTCTGCGTTTGTCTTCGCGGTGTCTGTGCCCTGCACAGACCCGTTCTTCTTCTTCGTCTTGCTCTTGACGGCGT
CTGTGCCCTACACAGACGCGTGCTTCTTCTTCTTCTTGCGCGTATTCGCGGCTGACCCTGTGCCAGTGTCAGCGGCACTCTGCGGCTGCTGTGTTGCAGT
CGTGCAGAAGGAGCCACCATCCTGAGTAGACTCGGGAGGCGTGGGTCCCTTATGGCATTCACATAGAACGGTGTATGTCCGGTCGAGGCATGCACTGAGT
TGTTGATGGCGAACTCCGCCATCGACAGACACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTC
GGTCTGCCTGTCTGTCTGCGGATGGTCCGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACGCTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGG
TGTCGATCCGACACAATGTCGATCGGCATGCCATGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACTG
CAGCAAGATGTACCATCGTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACAT
GGACTGCCAACACTCCCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCGCACGTTGACAAACCTCGCAAGCACAGACGTAC
TTGCGCACCCATTTATACTGGTGGGCACAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGAT
ACTCATACATGATCCTGAGTCGCAGGTCATGGACATTGGGCACGACAACGCGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCAC
CTAACGGCGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTGGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCCACGTCG
TCCGCGCACGCGACCTTCACGTCGTCCAACAGTGACGACGTCGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGCCGTGGCGTAGT
CAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCCAAGAATGAGAGCCATCTCGCCAT
CCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAACGACGCGTGGTCCGTATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTC
GCGGGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTAGTTGCACTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCAC
GACCCTCGTGATCGTGCTGCATCAACGCACATCTGATTGCGAAGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGAT
CGGCGCCTCAGTCAAGTCCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCGCTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGG
CGTATCAAGCCCGCGTAGTCCTTCACGTACCTGCACAAGTACGTGACCAAGCCAAGGAACTGCCGCAGTTCCATGACATTCGACGGCGTCGGCCACTCAT
TGATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACAAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCACTTCTTCAG
GTTCGCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGG
GCGAACACATCGTCGAAGTAGCTCGGTGCGAAATCGCGCGCTGAGCGCAACAAGTGCGTCGCGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCT
GCGGCATCACTAGCTATTCCCAGAGCATGCCGCTCGGCGTGCTCACTGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCATCGCG
CAGATCAAGAGCACTGTAGATAGTGCTCCTGACCATCGAATCGATGATAACATCTTTTCGAGGTATCGGCGTCTGCGCCGGATCGTCGCATCGTTCAGCT
TGTTATACGCATGAACGATGCGCCAGCCGCCCTGTGGTTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTT
GCGACGACTTTCGAAGAAGTCGTCGATCGCTTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGTGTGACACAGTACTTCGTGCCCGGCACGAGATCAATC
TCGTACTGGATTCCCTTGTCCTGCGGAAGCTCCGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGACTCGTTGAAA
CAACGAGTCCCAGGTCTGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGATAGTGTCCTCGCTCTCTGTGGTGGTCTCCATGAACAACTGCCTCAGT
TCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGTGAGAATGTATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCAGGA
CTGGAAGCGAAGTCAACTTCGACGCTTGCGTCGGAGGCTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGAACGCGTCAAGACGTTCAACGT
CTCAACGTCCGGCTTCTCAGCCTCCGTCTGCCCGGCAGACATTCCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCATGCGCCGT
CTTCTTGTTTTGCGGAGCCCGGCACCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGAACGGGTGTTCTTCTTTAGTACCGCCGGCGGGCTCATCCT
GCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGGGACGTTTGCA
ACCGTCCGCACCGCCTGCAGCGTCGGCTCCCGGTGCCGACACGCCATCTTCATCTCAACGCCAACCATTGGCGGAGACCCCCATTACGGAGGGTGCGTCG
GCTCCCCGAGCCGACGAATCAAATTCACCCAAGCCATCGACTCCCGGAGTCGATGGCGTTACGTCACCTTGGCTCTTATTATTGGCCAGACCTGATCCAA
TCAGATTCGCGTCAGCCTCCACGGCTGAGGCGTGTGACTCGTCTGCGTCATCCGTGCCCCTTGAGATCGGAGACTCTTCCTGATTCGCTGAAAAGCGGGT
GTCGATCTCCGAGATCAACACATTTTCTCCTTCAGCCGTCGGCGGCGATGCCGACGCTTGCTGCTCTTGCACGCGAGCTCGCGCGCGCCCAGGGCGTTCC
GGGACAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGC
GACCGAAGCGCACGAGGGTGCGCTTCTCCCAATCGATGACCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAACTTATCGTCCAGATC
CAGGACGGTAAACGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCATACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGT
ACTTCCAACATACTTCGATGTATCTTTAAATCCGCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAC
CACGGAGAGAGCCGCTTGCCCTCATCGAGTTCACATTCTGGATGACAAGGTCAGGCTTGTCATCTTGGTTCGTGCAGTGAGAATGAACCTCACTGGGGGC
TGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGTGCCTACTGGCGTCCAGCGTTTTTTGTTTGGTTGC
GACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGATTCTACCGCATCGGTAGCATCGCAC
ATTGCTGCTCC