Description :
From Genome Similarity Track
Location :
Scaffold_1080:3466- 5679
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_1080-abinit-gene-0.18Antigenic protein

Sequence
2213 bases(100 bases per row)
TCCTCCTCTTCCTCGTCCTCGTCGTCCTGCAGCGTCAGCTCGTGGATCGTCACGGCCTGCTCGTCAAGCCGTCGCTTCAGCGAGGTGCTCTGTCGCTGCA
ACGCTGTCAGCTCCCGCATCAGGTCCACGACTTTCTGTTCGTACTCGCACTGCAGGCTCTCTTTCTCTCGACCAAACGCCGCCGTACGCTCGGTCAGCTC
TTCACGCAGCCGCTCACACTCGTGGCGCAGCACCACCACGCCGGCACTCTCATTCTCTGCCGCCCCTTCGCAGCCGAGAGGAGACGACGAGTCGCTCGAG
CCAGACGCACTCGACGGCTCACGCTCGTTTCGACGCGGCGGACTCGTCCCTGAACAGGAAGTGGACCCGGATACCTTGCTCTTGGACGGCGAGACGTACC
GTGCCTTTTTCAGCAGCGTGTCGATCGTGTGGGCTTGCTCCTCAATCAGCAAGTTGGCGCTCAGCTGCGCACTCATGATCTCGTTCCACTGCTTGGCCTT
TTCGGCCTTGAGCTGCTCGAGCGCGTCGCCTTGCTGGTCCAACTGCTGCTGCAGGTCATCTTTCTCGTGCAAAAGCTGCTGCTTCTCGGTGGTCAATGCA
TGGACCGTTTGCTTCATGCGGTCGAGCTATAGCCACGCACCCACAAATCAGTCCATTTGGTTACTGTACGGTTTATGCCGCTTCCGTCGCCGCTCACCTC
TTCACGTCGACAGAGCTCGAGCTCCTGTAGCTGCTTGCTCTGGTCGGCAGTCTACCATGAAAGAAAAGAATGTGAGACCGGCACAGAATATGACCCCGAC
ACAGCAGACCACGCACCACGGTCGTCATCTTGGACAGATTCTCCATCAACTCTTGTAGCTGAGCCTTTTGGTCCTCGCTCCGCTGGGCATCGTCGCTCGC
CTTACGCTCCAGGTCCTTGACGTGGCGCTCAGTGCGGGACAGCATCTCCACGAGCTTCTTCTCCTTGGCGAGCAGCTCGTCGTGCTGGGCCGCGAGTGTC
TTCCACTCGCGCTGCCGCTGGTCGCCGTCCCGCATGGCCGCCTGCAGCTGCCCGGCAACGTCCATGTACTTGGCGTTCACGTCTTGGAACCGGTCCCAGC
GCTCGAGCTCCATCTCTTTCACAACCTCGCGGCGCGTCGCCTCGCGCGCGCTCTCGAGCTGGGCCTCCAGCAGTTCGTGCCGTTGCTCGGGCGTCTTCAT
GCACACCGTGCACGTGGCACTCGTCCGCTTGAGCCTCTTCTCGAGGTCCCAGAAATCACGGTCTTTTTCCTCGAGCTGCTGCTCATGACGCAGCTGGAGC
GACCGCAGACTCTGGCCCACACGCTCGTTCTGCTCGGCCGTCCGCGACCGCGACCGGAAGAGTCCATTGTAGTCTTCCTGAAGCATCACAAGCTGCTCTC
GCGCGTGGGCATTTGCCGCCAGTACCTCCCGCCACTTGTCCTTCATCTTGGTCACGACAAGTTGGTGGGCGACCTTGAGTTCGCTCTTGCCGGTCAGCGC
CTCTTGCAGCGCCGTCGAGAGATCGGCCACCTTGCGCTTGTACTGGAGCACCTCGCTCTGCACTTTCTCCTTGAGCTGCAGGCTCGCTGACTCGCGGTAC
CGCGCGTCGCCCACTTCTTTCTCGAGTACCGAGAGCCGTACGCTCGCGCGCGCGAGCTCGTCACTCAGCGGCGTCTTGAGTGCCACGAACTCTTTGCGCT
CCGCCTCGAGCTTGGCGCGCAGCTGGTCCACGCGCGCGCGCAGGGCCTTGCGCTCCTCGTGGCTGCTGGCCACGCTCGCAGCAGCTTCCTTGCGCACCAC
TGCGAGCGCGTCCTCGTGCTTGCGCTCGCTCGTGCGCAGCGTCTCGCCGAGCTCGGCGAGCTTGGCCTGGTCGGCCTGGTGCTGGTCCAGCGCCGTCTCG
AGCAGCGCGCTCGTGTGGCGGAACTGCTGCGCGTGGGACGCTGCCTCCTTTTCGCTCGCGCTGAGCGCCGCCTGGAGCGACGCGATCTCCTTTTTCAGTG
CAATCGCCTGCTGGCTAGCGACCGCCGCGGCCTTGCTCGCGGCCTGGTCCTTCTTCACGAGCTGCTGCCGCAGCGACTCGAGGTCTCGGAGAAATGCCTG
GCGCTCCTGTAGAGATAGATGAATTCAGTGCATTGCCGAGAGCACAGAGAAGCAGAGAGAGGGAGACCTTTTCAAAGCAGCGCTGGACGTCTTTGACGGA
GAGCGTGCCGGCC