Description :
From Genome Similarity Track
Location :
Scaffold_4:346515- 347912
Sequence
1397 bases(100 bases per row)
TGTAGTGGGCCTACCTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATGAGGAACCGTAGGTTTCTTTTACTTGAGTTAAGTATACTCGAGAT
CCACGAGTATACTTTAAACAAGATAAAGACTCCAAGTAGCGGGTTTTGGTAAAAGATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAAT
GTAATATTGTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGGTGCTCTCAGCCAATAGG
AATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGTCTTTGGTGTGTCTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAAC
AGACGTCGTATCTGTTAGAGTTACAAGTGACTGTAGCCACTTGTGCGTGTAACCCTGTTACACCATTCCCCCCTCAAGGTTAGACGCGCCGAGTTACGGC
ACGTCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTTGGGAGAAAGAATACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGACTGCCGC
CGCAACAGAGGGTAACCTCTCTGTTGCTCAGTACCATGAGCGCCAGCAGGCAAAGCGCGACGCGCTCGGTGCAAAGGCCGCGTCGGGGACAACTCAGTCG
GAGATAGTCCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGACTATGGGAGTGACGACGTAGAGATGGAAGAGGGCGAGGCCTCTTCCAACAAGCGCA
AGGAGTCTATCGACAGTGATAGTCTCGACCCGGCATGCGGGTCGAGACGCCCTCGTGAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTCGCGCGG
CGAGAGCGAAACTCCGCTCTCCGCTGCTGGGGCTTTAAGCTCCCCGCGTGAGGTGGCGTCTTCAAGTTCTCCGCGCGCTGCTCAGGCAGCGCGCGATCCG
TGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTGGGCAACACCGTGCCTCCAAATGAAATTCCGCTGTACGTATGCAGCGGGATCCACGATGATGCTG
TGGCGGAGGAGCAGCACTTTGATCCGTTAACGAATTAAAGGCGCGATTACTATATCGGACTCTTTCATGAGCTCCGATACTTCTCCAGCAAGAAGACCTC
TTCTCGCAGCAAAGTGCATGAGTGGCAGGCACTTTGTCAAAGTTGGAACGCTTTTGTTGAGAACTTCAACAAGAAGCCGGCTGCTTACAGTGAGCGGGTT
AAGCATGCCCGTGAGCACTTCGAGACATTCTCGACGCGCGGGAGGCTGGAGCAGCTCCATAGATCTTCTGTGGACGCTGGTATTCCATGCGCTGTGC