Description :
From Genome Similarity Track
Location :
Scaffold_9:346512- 349915
Transcript NameFunction/comments
Physo_434804PREDICTED: zinc finger BED domain-containing protein 1-like
Physo_525273Hypothetical protein
Physo_525438PREDICTED: zinc finger BED domain-containing protein 1-like
Physo_306671Hypothetical protein

Sequence
3403 bases(100 bases per row)
AGGTGACGACGTTTCCACTTTTAGAAAAAGCACGTTCGGAGGGCACCGATGTGGCAATGCAGCCTAGCCATTTTCGCGCAAGCGCTGCCAGAATGGGAAA
CTTGCTTCTTCGGTCCTTTGTTCACCACTCCAAAGGGCTCGTAGTAACAGGAGTGCCATGCGCATCGCTCAAATAGAGAGTCAGCTCAGACTCACACTTC
TCTTGCAGCTTTTCATCGTCAGCGGAAAGCTCTTCCGTCTTACATTCCTCCGTCCCGCCAGAAAACACATCCATGAGCCAAGCCAAATTGTCTTTTTTGG
CGCTTGACTGAGGTGTCGAGCGATTGGAAATCTGCCCATGCCTGCTTTGAAATTCCTTGGCCTCGCTCATTTCCTTAGCCATCTGAAACACAGCCATTTT
CAGCTTTGTTCTGGCAAGGGAAGCTTCGTCCCGACTGAGGTACTTGAACTCTGCTGATCGTGGGTCTAGCGCTGAAATCCATAGCAGCTCATCAGGTAGC
TTATCTTTCAATTTTTCGGAAAAGAGCTTGACATAAGTCCGCCGAATTGTCTGCATCCATGTCTCGACGCGATACTTGTACTCCTCATCACCGACAGATC
GAATAACTGGATCAAAAGCTTTGTCATTCTTCAGACTTCTCTGGATTACCGGAACTGCAAGCACAAGGGTGGGGTACTTCTGCCCGCCAAGCCCATCCGT
AGCTTCCGCAAAAGGTCTTAAAAGAACAACTAAACACCGGATAGTAAGCCAGTGCTCCGCCGTTGGCTGTTCTGCCGTAGAGTCCGAAAACTCGCCGGTC
TGGGCAACATACTCGAAAAATGCGTCCAGGGAGCTGCGATTTTCGATCATTCGAAGCAGCATGGCGTACGTACTATTCCAACGTGTAGCGCAGTCAGACT
GCGGGAGGAGTACATCGCGATTACCTTGAAGGTCACGCAAGCAGTCCATTGCTTTGGTCGAGTGACTGAAAAAAATAGACAACTTGCGAAACTTGTCAAC
AATTGAACGTAATTGATCCAGATGTGCCCGCGAGGTTTCCCAAGATTCTGCGATAAATTGATCGATCGCTTCGCATGCTTCTTGCTCCAGAGCAGCTTCA
AAATCTTTGTCTGAACTTCGCGGCAGCCAGCATTGCCTTTGCAGCTTGATCCGATTTCTTTTTCACGATTCCAGCACCCACAATTAGATGTAAAACGTGG
GCAAGACACGACATCGACTTGATGTCCATGATCTCGCATGCCCGTCGACCATTAGATGACCCATCGCGCAGAAATAGCACACACTTCTCTTTCGGTAGAC
CCCACCACACCATAATCTTTTCCAGACAGCTAGCAATGCGACGTCCGTCGTGCTTTCCCGGTAGCACCTTAATCTCGAGGACCCAGTTCTTGAGATCAAA
GTTGCGGGTAAGATAGTGGAGGGTGAACGAAATAAATGCGCGCTTGCTCTTGGATGTCCAGATGTCGGCCGACGCAGTGTAGTAGTCACATTCATCGGCA
ATTTCATCCTTTAGCGTTTCACGGAGTGCACCGGCGATGTTGTCGACATTTTCACGCGCTTTCCACGGCTTGGCCGGCTTGATATACCCTTCGACAGAGT
TCAGAAAACGGGAGTACTTCCGGAAATACTTGTCCTTCAGAATATTGAACGGCCGCATGGATTTGGCAACCCAAATTGCCGCCAACGTATCTGCTCGGGC
TTGCTCTTCCGCAGTAGCAGGCTCTTGACGGGTCGATCTGTCAGGGAGATCTTCAACTTCTTTATGCACGAGAACTTGAGTTTCCTTCTTTTTACGAGCC
ACCTCCGCTGCCTCCGCTTCTTGCAGCTCTTTGGTATGGAATTTCCCCATGTGTTTGGTGACGTACACCGTGGAGGACGTTTCAAACTTGATCTCAGTAT
TGCACTTTGTACAAAACGCACACCTCGCGTGTTCAGAGCGCAGTTCTTTCTCGGGCAACGTCGCAAACTCGTCCTTGCATACCAGTCTAATGAACATCCA
ATGTTGTGGCTTGCGCATCTTCCGAATGTTGAACAAGCGGTGGGGGCAGCAGCATCACGCCCAGCACCAACGAATGCGTTTGAACCCGCTACAGTAGATC
CAGGTGCGGGTGAACGGTTTTTGTGTTGGGGGCACTGAGAATTTCTGTGGCGGTCGCGGCTTTTCTTCGAACGACTCGGCGTGTTTCCAGTGCAGTCACT
TGGAACTGCACCGCTTGATCTTGTCACACACGGATTACTTGAAGCCAAGCCAGCAATTCTTGGCGATCGACGTCGTTGCACATTAGCGGTGTCGAGAAGC
CGAGCTCTTCCAGGTCGTTTTCAGCTGAGCGACCACCCCTTTTGCGGGTGTTGGCTTCGGTGCCAGAAGCCGATCGTTTCCCTAGAGCTGATTTTCCAGC
GATTCCTCCAGCGGTTGGAGGAGATGGGAAGTCCAAACGCGAAGTCGACGTGGAATGAGTTTGAGCAACATAATCAGCTAATCTGCTGCAAGGTTGGCGG
TAAGTAGAGTCTCTCGCGTCTTCAATCTTGGTTTCATCCTCAAACGTGAGCCGGGCACGAACTGGGGGGCTCTCGAGGGGGGATATCGGCGGTAGCGATG
GCTCGTGGTAAAATGATCGCGGCGCCAGGAATGCCTTGTACTGCTGGGCGCGATCACGCTCTCGAGATTGCGAAGGCGCAGCACCTGGTGCGCTGTGCTG
CTGTCGAGATTGAGTACTCTCGGCGGGCGTCATCGGAGCGGCTTGACGCGTGTCGGGCGACTCGCGGGGCGAGGGGGGGAGCGCATGGCAAATATCCAAA
TGGGCATCGAAAGGTCGCAGTGAATTACGTATCTTTACGTTCTATTTTTAACGAGTACGTAATTTTTTTTACGTAATCGTTCGCTAACCATCGTAACGTA
GAAAGTCCTACAAGGAACTAACTGGTTTTTAAAAGTGTTTCAAAAATATCACCTTTGCGGTTAAAAGCGAGGTTCTGCAGGACGGTATCGCTTACAGTAA
GTGTATTTTTCGGTATCACTGGCACCGTGACAGATAGCCAGCTAAGCCGAAAACAAATTCAAATGTATTTGCTTGCGTGTATAAGATATGTACATGTAGG
TGGCAAATCCGAGCATTCTGAAGTTACCTGTACTGTACCTGTATCTATTGTGCTGCTTGCACGGAAAGATGAGTCCCAAGTGCTGCGACACTGGAAGCAG
ATAACCTATAATATAAAACACTTGTTTGCATACGATCCATGCAGCGACTTTCGTGGCATTGCAAGTGACAAACCTGACCATTCTAAAGTATCATGTACTC
TACAACCTCTGCCCCAAGGTCTAACTACAAACAACACCGAGACGGTAGCTATACTGTGATTATTCGGCACCGGTACACAAACTTCTAGTAGTATAAACTT
GAT