Description :
From Genome Similarity Track
Location :
Scaffold_5:3465- 5793
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_5-snap-gene-0.31Vacuolar protein sorting-associated protein

Sequence
2328 bases(100 bases per row)
TTGATCATACACGCATGTAGCCTGTTGCCAGAGTGAAACTGTGGTTTCCAGTAGCTTTGCCCCGAACGACACTCGAAGCTCACCTTGTCCAATAAGGTGC
TCTCGTTTCCACGAGTCACGTGtGATAAGATACAATTGAAGTGCTAGCGATGAACCAGCCGGAGGCGGAGGGgCAAGTCCAGCCGAGTCTCCGCACCGCC
GTCTCAAGCTGATGCTGAAATGATGTGCAAACATGGCTTGTGGTGATGCAGCACTCGTCTTCATGGGACGTGACCACCGTGTATGCTGTTGAGACCGTGT
TTCGGACAGCCACGATGATTCTTGGTTTGCTGTTGGGTTCAACTCAATGGCAaCTCGCACTTGATCCCATGTACATAAATTATGGGCAGAAACAATTTCC
AGCTGGGCGTGCATCCGTTCTTCACGGCTATTCAGTTCAGACGTGCTCACTTGCTGTCTTACAGGCTTCTCaTCCGCcAAGCGCACGTCTCCGTGCTGGT
TTTGCCATCCaTTCCGTCCATCAGAATCATAtcTCGCTTCTTGACGATGGAGTTCTTTCAACAACCGAAGATCCTCATCGTTGAAGGCTGGAAACAGATC
CGCTTCGTTGTCAAGTGTGTACTCAAACACCTCCCCAGTGATGCAGCTCGTCTTCCGATACGTCTCAAGTACCGGGctCTTGCCATCCACAGCGCCTTCA
CCCTCTTTGCAACTAGAAAATGGTGGTGTCACGCGTAGAAGACCACTTTGCGGGTTACACCAAAATGATGCTAGGAGGATGTCATCACCAGCAGCGCGAG
TCGTGTCTCCATCAAGCCTCAAGACCAAGTGCATCTGCCTCGAGAATTCCTCCCGATgCACGCGTAAGGCGGCACGCTTGCGATTGGATGTCCATACAGC
AGCTGATCGGTCCGTAGTGTCCGCTCGTCGAGTTTGCATCGGGTTCCATTGATAATCATTAGTCAAATGTGACGGCGCCgCAACCGACGTCGACAGTCCT
CGCTGGTATTCACCGCGTGGTTTGTaGTtaTCACcATGTtCGTATGAGCAAAGCATCGCACCGTGGTGGTGGTTGACGCGCTCGCGCTCCTCTTTCGTGG
CAGAATCGACCGTGGTCTTCCTCGAGCGCCTCtgtttCTCTGCGTAGCAACTCTCTTGCCATTTGAAACACGCACTCCATGTTGTACCCAGCGGAGTAGA
CTGTCCTTCTGTCTTGTTtCCATGGCCAATCTTCCGCACAGTCACACGCACGCGGAGATTCTCGATCGGGTCCCGCGTGTGGTAGAACTGCGTCGTCATT
TTGCCATTTCACATGCATGAAAGGGCACAGTAAGTTCTTAACTATGTCATGTGTTAGCAACCGTATCTTGTGGGGTCGCAGCAGTCTCATGACCAAAGTG
GTCCCATGGCGGGTGCTCTACGACTGCTGTTGGTTATTGTGACCATTACGTGGCCGTGGCCGGCGGCGGCGCAGGACCGCACTGTGCGCGTACCCACGGG
CAGCGCCACTGTGCTAGTGGGAGACACAACGACACAGCAGATCCAGTgCGATGTCCTCCCAGGCACGTCGTTTCAAGTTGAGATCGCTGCCCTTGACGGC
AGTGGCGGTCCTGTGTCCGACCTTCGCTTCATTCGACCTCGTCTCGTCATCTTTGCATCGATGCAGCCCAACTCGACCTCCAGTCAGACGCGATCCTTCT
CGCTCTTCGGGTTCCACGAAGGCCGCTTCTATTTGACGTACAAACTCACTGGACCGGACGCAGATCGCTACAAACTTAGCgCCTTGACTTCCGTGGCTGT
TGTCACTGATCAGGCGCAAGGATGGCAAGGCATCTGGTACGAATTGGCGCTAAACGGCGCGATCTTCGTTTTTGGCTTGATGTTCTTCGCTTGGCGTCGc
GTCTATCGCCTCGACcTCCCGATCTGGAAGCGTCACGAAGAAGGTCTATTTGAACGAGCCAACTACGAGAACCTCCCCAAAGTCGCTTTCGAGAAGCGGT
ACCGTGATATCTGCgcTTCCACAATCCGTGAGCGTAtAGGGCAGTTTTGGGAGATTCCATGTGACGGAAGCTATGTGTGCTACACGTGTGGCATCCCAGC
TGCTCTTCTCATGCGTTTCCATGTCGATGCTGGCCACGTGTGTGGCATTCTTACATGCGTCAGTGTGGGGATACTTATTCCAGTGGTGAGTGTTTTTCAC
TAGTATACTGCTGCTCCGTTATAGCGTTTTTAGTGATTGCCATTGTAGAACTTTCTctCTGGAAAATCGCAGACGTCAGAGCTTGGCAGTTCATTTCAGC
AGACCACCATCAGCAACGTACCTTTGCA