Description :
From Genome Similarity Track
Location :
Scaffold_47:34649- 37192
Transcript NameFunction/comments
Hyaar_Emoy2806174DEHA2C00748p
Hyaar_Emoy2806175DEHA2C00748p

Sequence
2543 bases(100 bases per row)
ATAAATACATGTACTCGAACATATCCGAAATAGGTCCATCAGTCCTCTGGTATACGGATGCCAGTCCTTGCAGCTTCATCAACAGTAGTGTACAACCGTT
TCGCGCCGTCCATGTAAGCGCTAGTATCATATGCTGTAGTTCAAGCTGCACACGTCTGCGTCAGCTGAATTGCCACAAAGACTTCAATGTTGGATAGCTG
CTTCGTGATGTCAATGTAGGCTGCAAGTCCAGACTTTACGGAGAAGATCACGAGGCAATACATTGCCAGCAAGCAAAGATGTACCTTTAACCCGTGCGAC
ATACCGGAAAATGCTTCACCGATCTAATCCATCGTGCTCGGAACTTTCACGCACGGAACCAACACAATATCGTTAGAAAGTGATTGCACTTCGTTTACGA
ACGCCCACACAGCAGCCAGCACCGTCACTAACAGCGTACCAAGAACTTAATGCAGCGCCAGATGGGCTACACCGAAGATATAAATGTAGTCGGCTACCCA
AATGGAGTCTAGCGTCGAGCTGGCCTGTGCAAATACTCGCTCTCGAAGTCTGACGGTTGAACATGAGCAATAATGGGAAGGCAAGTGAATGCACAACGTT
AGCAGTAGCGTCCATCCACGTGTAAGCAATATCGTGAGCCAAGCAGCTCATGCGCGATGGTCCCTAGTCACCGAGCACTTTTTCCATGCTCGTGTGTATC
CCTTCAGCATCCGACACACTGCACCAGTTGCGGCTTCATCAGTTATCAATGGTCGACGATTATTTGTGCGGCAATCGGTGAGGACATCGATTATCGTTGC
CACGAGAATGCCGAATGGAGGACCCATCAGTCGCGGTAGCTGTACAGCAAACCCCGGCAGCACTGTATCGAGGTACGGACCAAAAGTAGCCCACTGCGAC
GACAACGCCATACGGATAGCCATTCGACACGGATTGGAGCACAAACTTTAAAATGGAGTACCTAACAGCGAGTTGCTTTCGCGAGAGTCAGCAAGGTCAA
GGTGCAAGATCATCGACGATTGCAGCGAACGTTCTGGCTGTCTCAACGCTGCCAATCTCCAGTGCTATGACTCGGCAGTTATCTAGTGACTTTGGCGTTA
GTCACTTTAAAGTGCACGATGACGGTGAGCACTTGTGGTGAAGATATGTAGTACGGTGCCTTGGATCGCTGTGAATGGTTTGCACCAAAGCTTTACATTC
GCGATGGCTATTGAAAACAGCAACGTGATTAGCGTCTGTGCACCGCTGTTGTCTCCACGAGTGCACCAACGTCGCGCAACCACAATTTATGCCAGCAGAC
AATGAAGCAGGGTGCATGCGAGACACTGGCTCAGATTTGCCACACATGCTGATCGTTTTAAATGGTGCCATTTCTCTTTTCTGTCCCATTTCGTTTGATT
CATCCATCCAGCAAACTGATAAAATATCGAAATCTCCACGCAGCGAGCAACATTTCGCTACCAGGCGTTATCGATGGTCTTCGTTTGCTTGGTTTCCATC
TCCGATGGCATAAGAGGTCACATTTGTAGCGACCGGTAAATACTTTGAGCGCTCTGCATGCAGCAACGCCCAGACTAGACGGAACGAAATCTGCACGGGT
GTGTACGTGCGCAAAATGTGGTGTCTTACGCCGTACCATTGGACTTGGTCGTCGAATGCTCGCGTAGATCGCGCATTGCTAGCCGCATCCTCTCCTTCGT
CTGTTGTTTCAAACTTTGAAAAAACGCCATATCATCCTGCAGCTCCACCAGCAAGTCATGGTTCATGCCGTGCACCTGCGCTTCTCGGTACGACTTCCGT
AAATCCTGCAGAATGTCTAGCACATGCTTTAAATGGCACGTATCCCGATCCCGTTGCTCACTCAGCTTGTGCCACTCGTGCAGCTGCATCTTTGTTTTCC
CTAATCTTATGGACTCCATCAACTGATCTGTAACGACCGTTCGACAATTGCCACATAATTGTCCATCTGCTGCTACACTCTGCGTATAGGAATTGGCGAT
CCCACTGAGAATCTCCAAATCGGTCGTTGGGTTGACCGACGGTTTTGTCAAAGTTGGAGGGTACTGCATTGGCTGAACCGACACAAGGTTCGGTTGTCCT
CCTTCATAGAAACCCTGCAAATCTGCTGCAGCTGCAGACGTTGCAGCCGTTGGAGTCTGCATGGTCATAGTGGGTAATTTCCGCTTGTTCGTCATGTTAG
TGATGATCTGGACTTCATTTACGGTGGTGTCCCCAGCATTCCGAAAGATTTCTGCGTCTTCGGTCTCCTCTTCTTCTCGTTTCGACGATTGGGTACTTTG
CGGTTTCGAAATAGGACCATCATTTTTGCGTAGTAACTCAATGTACCCATTTTTGTTATCGTTCGCGTTAGGTCCCTTTTTGATGGGCCGAAGGCCACGA
CGATAGCACTCGGCGCGCAGGTCGTGGGCGCGGTGGCGGTCGTACGGCTCATAAAGGAGCTGCGAGGACTCTTTTCTTCCTCCCGATTCGTTCGACAAAA
GGGAATCGATATCGCCTCCGTTGCTATGGACGTCGCCCACGAG