Description :
From Genome Similarity Track
Location :
Scaffold_9:346375- 347498
Transcript NameFunction/comments
g5565.t1OWZ24477.1 Protein phosphatase 2C [Phytophthora megakarya

Sequence
1123 bases(100 bases per row)
GCACGCTGGATAGCAGCAGCTACGCGACCGTCTGGGACGGTCTTCTCGTCTCCATGAGCGGGCTCGTTCGTCCCCGACTTGTACAGGTACGACAGCTCCT
TCTGCACGTTGCCGATTAGCGTCTTCCTGGCGTACTCCGACACCTGCCAGCCACCTGCCAGTTGCCACCGAAGCACGATTAGAGAGCTCCGAAACATGCA
CAGAAAGGCTCCAAGAACTGATGCTGTACCGTGGCCATCCAGCACAGCCGCAAACACGTCGCCCGAGTCCGTCGCCTCGACCGCGTACTTGTCCTCAATG
GGGAAGTTGGCCTTGTACGACGCGCTGCTGAGGCGCGTGGCGCGCGACTTGGCGATGGACGCGAATTCCTCGCGCTCGAGCGGCACGGAGAAGGCGCCGT
CCACTTCGGGCGGGGCGTATCTGGCGTCGCATTGCGCCTCCAAGTGCGCTCCGCTCACGTCCGCGTTGGCCAAGGCCAGCACCGACAGCCCCAAGCCGCT
CAGCAGCAGCGCCTGGCGCAGCGTCGAGCCACGATACTGCAAGCAAGAAAAGTCAGTGTTGCGAATGGAAGATTCTACAGCGTGTACGCTCGCAAAATTA
ATGGGGAAGAATTGGTTGAAGAAGAGAGGAAAGTAGACAGGGGTAGAGCGCTTCCTACCTTGGGGCTCTGTCGGCTGGTCAAGCGCGCCAGGTTCCGCGC
CGCAAAAAGTCGCATGCTTGACGTCAGTCTTGATGGTTTATGAAAAGGGGGATCTGGGGTGGCTATGGTGTAATTTATCGTTTTTGGTCGTGTAGTTGAC
GTTGAAGCGAGGCATGACCAACATGTTTGCGGTTGCGCTTTCGTGTCAAAACGAAGCAAACAAATGCATCTACCGGTGGATGAAGAGCTGGGACTTGCGG
CAGAATTCCTGGCAGTTGTGCAACCAGTCGTAGATATTAAGCTCTGCAAATGTTACTGATGCTGTGGTCGTGAGAGCTGCCAGAGTCCAATGTAGCAGGC
GTCGACGCTCGGGGTCATCACCGTCGAGTGTGCAGTGGTCGAGTTGGACGCAGTCCACTTAACGAAACGTGTTGGGCAAAGCGCTGTCCACAGAAGATCG
GTATTATGGGAAGCGCTGACGAC