Description :
From Genome Similarity Track
Location :
Scaffold_56:34637- 38050
Sequence
3413 bases(100 bases per row)
CAAGTACAGTGGAGTCGAGGAAAACTTCCTGTTCGGATGATTCATCGAGCTGGACGATGCCATAAGGGCTCGTCACATCGTTGATGAGCAAATTCAAGTC
GCATTTGCTCTACAGAACCTGGCAAGAAGTGCCGAAACTTATGCGCGAGAGCTCTAGCTGCACGACCCATATGTCTTTATGTCGTTGGATGGCTCAAAAC
CCGACCCATGCAAACGTTTGAGCCTCCAAGGGCTGATTCAGGGCTCAAACAGAGCTCCTGAAACTCAAGCAGGGTCAGCGTGATGTACACGCTTACGCTC
AGCATATACGACTCCTTGCAAGTTGCATAACGAACGACCCAGTCCATGAACACACATCGATCACGGTGTCCATGCAGGGTCTTGCGGATTGTCCCGTCAA
GACCCACCTGTTCCGCGTGAAAATGGGTACGAGAGAACAAGCGATCTCAATTGCAGAGCAGGAAGACATTTTCTTTGAGGCATTATCAGGCTAGTTCGTA
TTCTTATCGTTCCCGACGATGACAAGAAGTCTGAGGTCCAGAGTCTATGGACCTCTGTTATGTCGATAGCGAGAGACCTTGCTCTTCAAGCAACAAGCGA
TTGCAGGGTTGCAAGCGCTGTAAGAAGATATGACACTCCGCCTATGAATGTAGTGCCCCACGTCCATCATCTCGCAGTGCTGAGCAAAGCGATTGGCCGT
TTGCCAAGCAGGACACAGACGCGATCCGACATTGTTGCAAATTCGCAACAACAAGACAGATCGTCCAAAACCAGTAGAGGCGGAGCACCCTACCGATCCC
TCAATTGTCATTTAAATTTGCAAATCTTTCGACGAAAGCTGTTTCAGACACACAACCATTGTGTGTTTCTGCATTTGGTGATAAGGTATCTCTTGTCACC
TTGAAGTTGGTAGTGAAAAATGATTTGTAAATTATACTTCTAGTAGACTGTGGGAAGTCGTGAAACTTTGTTCTTTGCCAGTTCCTAGAGGGTCTTAGGA
TTAGTTCGTTGAGCCTGACATTCCTCCAACAAAGATGACGGTGCGCCTCAAAACATGTGCATCGATAATGATGATGAAACGTGTAATGGAAATCCACTAC
ACGTTAGAATATTTCGAGCACGATGATGAATTCATCGTACTGGATCTGGTTGACAAATTTAGGGTCATTCTGGGTTTACCCTGGATCAGAAGATACGAGC
CAAGGATCAGCTGGTAGAAGTGAAAGGTAACAATGCCTATTAATTTTTCATCCGATGGCTACCTGATTAACGTCTTGTAGCTTCCAGAAGTGTGTGGAAT
TCCTACGAGATATTGCGATGAACTCACTTGTGGTACGGTTGCTAGCAAAACTGCACAAGACTACAGTGTAGCTCTTTACTATACTGAAGAAAAAAGGGCC
GGCGGCTGTCCAAATGTATATACACGGTCAGAGTTTCACTACTCGAAAAAGTCGAGTGGACCCGGAACATGGATGCATGCCTAGGGGACAGCATTAATGA
GAGAATAGACCGATTTATCAGCAATCACAACACTGTGATTCTAGGTAGACTAGTGAGTCGACGTAGAGGACGTAGCTGTGTTAGCTAAACTGCAGCTATA
AGACTACGGCGTAATAAATCCCTACGTACTTGGGGAATAAATTCATCAAGAAGGTATTGCCGAGAGAACAAGTCTCGAGCATCCTGGGGGAGTTAGTCTC
CAGCAGCCTGGGGGAAGAGTACCCAGGAAATAACCAAGACATTCAATGTCTTGGTTGATTAGAAATCACGTGTCGGCGCTTATACGCTTGATCTGGTTGC
GTCTCCCAAGTTAACTTCGGAGTTCAATCAATTGCCAATGCTCGAAACGAAACGGTTTTTGTGAGATATGCGTAGTGACAAAGTCAAGCATGTCTGTGTA
CTCGTCGCAGAGGACGAGTACATGGCCGATATTCGATCGACAGTTGTTTTTACTGAGAACGAGCGGGTTCTCAGCATATCATCGATGGACAAAAGTGTCC
GAAATGAGAGTATATGATTGGACATTATACGTCTCAATCTTAGTATTCACTTCAGGTAAATCCTTTATACAAGGGTTGGTCGAATTCACGAATGTATTCT
CTGAAATCAATCCATGCGAGTTTCCCAAGGAAAAAGGCACTCGACATGAGGTCGAGATGAAATCGGGCTCGAAGTACTGTGTCACGCCTCGTGAACAAGT
ACTTGCTATCCATAAATTATTTTGTCGATCGCTTAGCAGCGGGATGTGTGAGGGAGTCACCCTCCCCTCATTGCTCTCCGACCTTCTTTCTGCGTAAGGC
CACAGGAGGACGTCGGATAGTGCACGCATTCAACAAGACAGATGCTGCAAAAGTAGCGGCTAAAACGCCAATACCAAGAAAGGACGTCATCATAGATGGT
ATAGCAAAGATTACCATGTTTCCGTCCATGGTTCTGGTGGATGGCTTCTATCCAATCCTTATGCGTGAAGGAGGCGTCCCCTACACCTCAGTGAGATCCC
AATTGGTTTGTTGTGGGAGTGAATAGTTATGACACGAGGGTTAAGTAATGCCCCTGACACATTCAACAGATGTTTTACAGATCTGTTGAGACCGATGCGA
GGTTTTGCACCTAGTTACTTCGACGATGTGCTCGTCCATAGCCGGGCTATAGACGAAATTACGGACGTGGAAGTCCACCGAATCTTCATCCGTAAGTTTA
TTACACTTATGCGTGAGCATACGATGTACGCCAACCTCAAGAAGTGTATATTCGCGGCAAGAGAAATACCACTTCTTCGGTACATGGTCGGAATATACGG
CGCACGTACCAATCCGGAAAAGACCAAGACAACCACCTACTATCCTGTACCATTTGATGTGAAGGGATTGGGAAGTTTCTTGGAGTAGTGGTACTTGCAC
AATAATTGTGCAACAACGCAGAAATGACCATTCATCTCTGTCATTTGTTAAGAATAACGAAAACTGGTCATGGAACACTGGGTGCCAAATTTCCTTTGAA
GGTATCAAGCAGAGCTTAATCGCCCATACTGGTGATTACGGATCACGACACCATTCCATGTGGTCTTTGACGCAAGTGATTATGCAAGCGGCTGCGCGCT
GACGCTATACGACCCAGATGGAGCTGGGCGCGTCACCTCCAGGCAGCTAAACGAATTTACCCAGTTCATAACAAGTAACTACTTGTCATGGTGGTGAATT
ATGCATTGGAGAAGTTCAGGGTCTATTTGTTAGGGGGATAGACCCTTCATCGTGTACACGGATTATGCGTCAATACGCACAGCCGTAAACAGTCCACACC
CTCTCAAAGAACGGCGAGGTAGCAGTCTTTTTTCGTGGAGTACAAATTCTTCTTGGAGTACAAGCCAGGGTGATTTATCGTCGTTTCTGATGCGTTGTCG
CGTCGACACGATT