Description :
From Genome Similarity Track
Location :
contig_6:346248- 348325
Transcript NameFunction/comments
g1833.t1hypothetical protein

Sequence
2077 bases(100 bases per row)
CAGATGACACAGGTCGACATCAGCACCGTCATCAACCCCGAAGATAACTCGTTGAACGAGGATTCCGTTCGAGCCTACGCGCAGCAGTATGTGGGCTCGT
ACTTGAACACGATTTGGGATGAACCGCTGGGCGACAAGTACGGGTGGACTGCCACCGAATGGCGCGCTGTGGTGTCGCGGATTCAGGAGATCTCCATGGA
GGAGAACGGCGGCCACCCCATTATCTACGGTCTCGACTCGGTGCACGGTGCCAACTACGTGACTGGTGCTGTGATCTTTGGCCAGCAGATCAACAGCGGT
GCTAGTTTCAATCCCGACCTCGTCTACAAAGCGGGCCAGATCACTGCCCGTGACACTCAAGCTGCTGGAATCCCGTGGGTGTTCGGACCCATCTTGGAGA
TCTCGCAGAACCCGCTCTGGTCTCGCACCTACGAGACGTTTAGCGAGGACCCCCACTTGGTGACGGTCATGGGCGAGGCGATTATCCGTGGACTGCAGAG
CTACAACCAGACTGCGGCCTGCATGAAGCACTTCATCGGCTACTCCAAGACACCGTCAGGACACGATAGAGACAACGTCATCATGGACGACTTCGACCTG
CTCAACTACTTCCTGCCGCCGTTCAAGGCGGCCATGGACGCCGGTGCCATGTCGACGATGGAGAACTACATCTCCATTAACGGCGAGCCCGTTATCGCGA
GCTCTCGCATTCTGAACGACCTGCTTCGCTCCGACCTGGGATTTGATGGTCTTCCTGGTTTCCGACTGGGCTGAGATCAACAACCTGAAGGACTGGCATC
GTGTCGCTGAAACGTACGAGGATGCTGTCCGCTTGTCGCTCACGCACACGTCGCTCGACATGAGCATGGTACCGAATGACACCGCGTTTATCAACTACAC
GGAAAACATGCTCGAGGGGTACCCTCAGTACGAGACCCGCCTCCGCGAGTCTGCCAAGCGCATCATCAAAACGAAGCTCCAGCTTGGACTTTACGAGAAC
CACATGCCCGGTGCGGAGTTTGAATTCCAGGTCGGCAATGATGAAGACAAGGCGGTGGCGTTGGACTTGGCTCGCGAGTCCATTGTACTTCTGAAGAACA
ATGAAAGTGTGCTGCCCTGGCGAAGGAGGCGTCTGTGTTCCTGACAGGCCACTCGGCTGACAACGTCGGTCACCAATGCGGTGGATGGAGCATCGCGTGG
CAGGGATACTCTGGCAACGAGATGTTCCCAACGGTGTCTCGGTTCGTCAGGGCTTGGAGAACTTGGTTGGAAATGACTCCTTTTCCTTCTTCAACGGCCT
CTACGACAATGGCTCGTACTCGGAGGCAGACCTTGCCACAGCAGTTGAGATGGCTCGTCAGCATGAGTACACCATTGCGGTTATCGGTGAGAAGCAGTAC
ACAGAGAAGCCCGGTGACATCGACGACTTGGCTCTCCCTGCTGGTCAGATCGAGTACGTCGAAGCGCTTGCTGCCACCGGTACCAAGGTAATTGTCGTCT
TGTTCGAGGGTCGTCCGCGTCTCCTTGGCTCGCTCCCGGACTCTGCCAGTGCGATCATCGATGGTCTGCTGCCTTGCGAATTGGGTGGACAGGCGATGGC
CGAGATCATTTACGGAGACGTGAACCCGAGTGGAAAGCTCCCGATCACCTACCCGAAGGACCCGGCGAACATCGCCATCCCTTACTATCACCGTGTGAAC
ACGCAGTGCGCCTACGACCACTGCTGGATGGAATGGGACTTCGGTGCCGGACTCAGCTACACGGAATTCAACTACTCTGCTGTGTCTCTGGACACGACGG
CGATCACTAGTGCTGATGCCACCGTCACTGCCACTGTGACCGTCACGAACGTGGGTACCCGTGCGGGTAAGGAGACGGTCATGCTGTTCCTTACGCAGCC
GTTCCGAACGATCTCCGTCCCTGAGGTGAAGATGCTGAAGAAGTTCAAGAAGATTGAACTGCAGCCAGGAGAGTCCCAGGAAGTGTCCTTTGCGCTGACG
GCGTATGATTGGAGCGTGTACGACCCGCAGATCGGCAAGGGGTTGAAGAAGATCACCGAGGACAGCAACTACGTGGT