Description :
From Genome Similarity Track
Location :
contig_38:346226- 354940
Transcript NameFunction/comments
g8385.t1POM57413.1 Ribonucleoside-diphosphate reductase small chain [Phytophthora palmivora var. palmivora
g8386.t1POM57413.1 Ribonucleoside-diphosphate reductase small chain [Phytophthora palmivora var. palmivora
g8387.t1OWZ24833.1 putative membrane protein [Phytophthora megakarya
g8388.t1XP_008911523.1 hypothetical protein PPTG_16025 [Phytophthora parasitica INRA-310

Sequence
8714 bases(100 bases per row)
CCAAGATCTACAACGTGAAGAACCCGTTCGACTGGATGGATATGATCTCGCTGCAGGGCAAGACCAACTTCTTCGAGAAGCGCGTGGGCGAGTACTCCAA
GGCTGGTGTGGGTGTCGCGGCCGAGGACCAGGTGTTCACTCTGGACGCAGACTTTTAAGTCCGTGTCTAAGATGAAAGTGTGGGTCGTCCATGTCTTCGC
CCGCAGCGCACCATGCAGCCCCTCACCTCGCGTGGTTCGAAAGTCTTAAGATCGCAGCGGCAGTGTATATAGCCAGCTTCGTTGCATATTTAAAAAATCA
ACGTTGAGTCTACAACCTCTCCTCTTTTTTCTGCTACAGTCACACCTCCCTAACTGAGCCTCTCTACCTGACTATGCGCTCTTTATCTGGTTGTCATCCC
TGTGTGCAACTGAGTTTATATGACTTTCACTGAAGAAGTTCTCTAACTGACTAAAACCCTCCTTATTTTCTAACTGACAGTCCCGGAGGGTGGAGGAACT
CCCTAAATGCACGCGTCACAAAGTTATCAAGCCACTTTCACATGTTGATGTGCACTTCTTCCCTCCGAATCTGACTTCGTCGGTGCAGCCACTTGATGCA
GGTAAGCTTTCGGACATATTTGGCTAATGCTTGGTGAACTTACTGATTGATAATATATTTGTAGGCGTCATCCGATCGTTTAAGGCACGCTACCATCGTC
GATTTGTCCGCTGGTGCCTTGACGCAATGGAAGGCGACTCAAGGATCGTAGACGCTACGTTGTTGGGGGAGCTCCGCCAGGAAGGGGAGTATGCGTTGGC
TGCTGAAGAAAGTGTGGTAAACCATATTGTGAGCATGCTGGAGCCCACGACAGTGTTGCCCATTACTTGGAGATTGATTCTGACGTTGAAGTTCACGAGC
TCCCAGAAGGCGGTGCCGAGGACGATGATGCTGAAGAGGTGGATGGTGATGTGGACGACGAGAACGACAAACCCCCTGTGTCAGCATCGACAGCACTCGC
CTATTGTATGGAGCTTTCTTCGTTTCTATTCCAGTGTGAAGGGGATACAAAGCGGGAACAGGAAATGATACAGACCTTGACAATGGTAGCTAGAGACCAA
GTAGTGAAGTGGCGGCGGCAGACATCACTGGATACCTTTTTAACACCAATGTAAGTGTAGCCATTCCCATATCTGACACATTCTCTAAATGAAACAACGT
CTCGGATCAGACAGATCGGGCGTCACTTATAGAGGTGTGACTGTATGACATCCCAATCGTGAGCCCCTGGTGCAGTCATTACAGTAATTAGTCTGTCCTA
GACTAATTTTTGTGAGCTGCTTCCAGATCAACTTACACTAATAAATAGTCTGTCACCACCGCGTACAGACTAATTTTGAACACAGACTACTTTTGAACTC
AGACTAATTGTGAACAGGGAACGAAAAAGTATCCATCTTCCCAGTTTAACTACACTAGCGCCTCGTTGCCTGCATCATTAATCACCACTGGAATCACCAT
TTCGTTTCCTCCTGAGCCTCATCAAAGCTTCTTCATCGACGGCCACGGTGTCTGTAGTTGGGGATTTTCCGGCAAACTCCTCAGGGTATTTCTTTATGAT
TTCCTGTAAGTGCGGGAACAACTGCGTCGTACGCCAAGTTCCATCAACACTAAGTGATAGGTCACACCGCATCATAGCTTTCTGCGTGTAGTTTATCCCG
TTGTGGTCGCGCTTCGCGTTGACTTCCTTGACAGACTATTTTTGAAGCTTTGTTGACAGACTAATTATGAACCTTGGGAGTTTTCATTGACAGGAATTAG
ACTCATTGTGCATACATACTAATTTTGAACACAGACTAATTGTTGTAATGACTGTAGCTGGTGGCCTGTACAGTACCGGCCATTTACAACCGGGGTTGTA
TTTCTGGTGATCCTCCATCGCTGCATGGCTGGATGGGCCGTATCAACCACGACAGGTGGCCGGTACCGTGCTAAAAAGCGGGGTGGCGTTTACAAATTTG
GTTGCACGCACGGTGGCAAGATTTGGCCAGTTTTGCGACCCAATCCAATCCAAAAACCAAGTCAGGGCTGCAAACAGACCCAGTTCAAGGGCCCGCTTAA
CAACTTAACAAAAACCTGATGGAGGTTGCACTTGATGCAAACGTGCAATGAAGAAGCATGAACGCACTAAAGTTGCCACGCCAGGTTGATGTTAGCTAGC
TCATGACGTGTATACTGTACGAGTACGTGCCTCAGTCCTCAATACTGTACAGGTAAACGCGGCTACCAGCTACCAGGTGCTCACGATTGGTATGTCATAG
CAGAAAAAAGAGGAGAGGTTGTAGACTCAACGTTGATTTTTTAAATATGCAACGAAGCTGGCTATATACACTGCCGCTGCGATCTTAAGACTTTCGAACC
ACGCGAGGTGAGGGGCTGCATGGTGCGCTGCGGGCGAAGACATGGACGACCCACACTTTCATCTTAGACACGGACTTAAAAGTCTGCGTCCAGAGTGAAC
ACCTGGTCCTCGGCCGCGACACCCACACCAGCCTTGGAGTACTCGCCCACGCGCTTCTCGAAGAAGTTGGTCTTGCCCTGCAGCGAGATCATATCCATCC
AGTCGAACGGGTTCTTCACGTTGTAGATCTTGGATGCACCCAGTGAGTACAGCAGGCGGTCGGCCACGAACTCGATGTACTGGCACATGAGCGCAGAGTT
CATGCCGATCAGCTCCACGGGGAGCGAGTCGCTCACGAACTCGTGCTCAATCACCACAGCGTCACGCACGATCGCGTGCACGCGGCTCTCCGGCAGCTTG
TTCACCAACTTCGAGTACATGAGGCACGCGAAGTCCGTGTGCATGCCCTCGTCCCGGCTGATGAGCTCGTTCGAGAAGCTCAGACCAGGCATGAGGCCGC
GCTTCTTGAGCCAGAAGATGGAGCAGAAGGAACCCGAGAAGAAAATGCCCTCCACGGCGGCGAACGCCAGCAGACGCTCCGGGTAGGACGAAACACGAGG
GTCACACCACTTGAGCGCCCAGCGGGCCTTCTTCTCCACGCACGGGATCGTCTCGATGGCACGCAGCAAGTGATCCTTCTCCACGGCGTCCTTGATGTAC
GTGTCGATCAGCAGCGAGTACACCTCCGAGTGGATGTTCTCGATGGCGATCTGGAAGCCGTAGAAGCAGCGAGCCTCCGGCACTTGCACCTCATTGCTGA
AGTTCATCGCCAGGTTCTCGTTCACGATGCCGTCGCTGGCAGCGAAGAATGCCAGCACGTGCTTGATGAAGTGGCGCTCGTTGTCCGTCAGGTTCCCCCA
GTCCTTCAGGTCGTGCACCAGGTCCAGCTCCTCGGCCGTCCAGAACGACGCCTCCGCCTTCTTGTACATCTGCCACACGTCGTGCTCCTGGATCGGGAAC
AGCACGAACCGGTTCGGGTTCTCCACCAGGAACGGCTCCGGCTGCAGCTCGCCGTTCACCTCCTTCAACTTGTACTCGGACATCTCGAGCTTCGGCTCCT
CCTTCTTCTCCATTGTTACCTTGGCGAAACCCTCCACGAACTGCGGGCTCAGCTCCTGCTCCGGCTGCTCCGGCTGCTCCGGCGACTTGTCTGCGGCAGC
GCGTTCCAACGAGGCAGCGACCATTCTATCTGGACGGGTTGGGTAGCTGCTTGCTTGCTTGGTGCAAGAAGAAGCTGAGCGACTGCGCGGTGGAGCTGGA
GGAGTCGCTTGAGGAGTAGAGCGCCAAAGCCAAAATGACAAGCAGAAGAGCTCGACTTGCTCGCCGCGCGCCAACGAGCCACGCTGGCGGAAAAAAGCGC
GGGGGTCTGTTGCCTGGTACACGCTGCATAACAACACCTGGTGAAGCAAATGTAGATATTGAAGGCGAGGACGATGGAGGATGATGTTCATCTGTGGTGT
TGTCCACTGCATCTTGAAATGCATCTGATGGTGATTTTTTTCTTGCGGCAACAACGTCGTTGCCATGTTTTTTAAAACTGGCAAGTTTCTTCACGACCTT
GTTTGTCACCTTCGGACACCAATTTGCATCTTTTCGATACATTGACAAGAACACTTTACAGGGTAACGTATTGTACTTACCGCTAATTATTAGAGCAGCG
AGTGGTGAAGCCGAGCGAGATGTGACCATGCTTGGTTCTGGGTTTAACTCCGCGTGCTGCGCACACGTATGTTAAACCACACGCGTTGTTTTGGCTTTCA
GAACGAGTTGGCATTCACCCCTTCCCTAGCGTGTTTCAACCAAGTGCATGATGTCGTTCGGTGTGCAATACTTCTATTATACGCTGCAGAGTGCTTGCAC
TTGTGCAGGGCCCTTTTTATCCTGTCACCGACTCGTTAGCTATACACCGGGAGCTAGCCCGACTTTTTCTATCAGCGATTTACTTGGATGTGGTGGGCGC
CACAGACACCGAGTGCATAAAATCCATGTTCAGACCGTCGTCTTCGTCCTCATCATCGAGGCTGTCGATGTCAATCATGCTGCTCTCCCGGGGTTGGACA
GATGACCGTTCGCTGTATGCACCAGTGGAGCTGCGTGTGAACTTGAACTTCTTCTTTTCTGTAGCATCATCGATAGCTGGGGGCTCTGAAGCCGGCTGGT
CTTCGAGTTTTCGTCCCTCTGATGCAGCGGAGGATGCATGGGACGACCCCACAAACGACGTAAAAAGATTGTCGTCCTCGCCTTCGAATTCATTCTCTAG
GGCATCCACGTGCGTGATCTCGACAGGTGCAGGAGCTGGAGCTGGCATGACGAATTCGTCAACCGATGGCGGTGATGGTGGATCGCTGCTCGATCCCGTC
GAAGAAACTCTATCGCTATAACGCAGCTGAGACGTTGCCGGATCTTCCTTGGGCGTCACTTGCTTCGCCTGAGAACGCTCTGGGCTGCGGCGCTCGCGTC
TGTGGTCTGTTTCCTTGGTTGGGCTTGAGACTGGAGCCGTGTACTTGGGGACGGCGCTGCCAATAAAGCGGCCTTCCTGGTCAACGGGCATGGTGTTTGA
CACGGGGTGGTAGTTGGTGAAGTCCTTCACGTCCATCGTATCGCGGAACTGCTCATTTATAGGCGATGCATCAGCATTGCCGCCAGCAGCGCCAGCTCCG
GCCACCATGTCCGTCGTTAACCAGTCGCGCACTCCCGTGAACGGGAAACCACAGCACGTGGGGCACTTGGGCGTGGTGGTGAACGTGTGCGGCGAGCATA
GCGACGAAACTGCGCAACGCCTTCTTGCGGTAGTTGATCACGACGGGCGTGACGCTCGTGAAGACGTGCTTACGCGGGAACTCGAAGAGGTTGAGCACCT
TCTCGTAATTGCGGCACCCGGGGCATTTCTTGTCCGTCTTGGCGAAGAACTCGAGGAGGTCGTTGCGCAGCTTGAGGAACTCGGAAAAGCGGCGCGCGAC
TTCCCATACCTGACCGGAGCGGATGTTGACTACGCGCACGTGGTAGCGCACCTTGCCGTCCTCGGACGAGTCCACGGTCGGGATCTGCACGCGCACGAGG
CACTTTTCATCCACGCGGCCCAGCTCGCCATTGCGCGAGTAAGCGTAGCGCGCGGTGGGGTTCATCGGCGGAAAGGATCTATCAGGGCGGGGCTTGGACA
GTGCGTGCAAGCAGGCGGGTTGGCGAATGACGCATGATATCCGCTTTGCATCGCAGTCGCCCGACGACGACCAGACGTCGAGAGTGCTTGACGTTCGTAT
GGAGCTCCTCGAGTAAGACGCCAGGGGTTTCAACAGATTTTCGGCCAATGGGACGGGCCCGATGGGCCATCATCGAGGTCCCACCTTGATCATAGTTGCA
TCTAGCTTCAGAGAGTCGGAAATGACTTGATATTTGTATGCCCTCCCAGCGAGATAGCCGGTACGTTTCACAGAACCTGTGGCTCGGCTCCGATGTGGAT
TGTGACGTCAGCGTTACGCAAAAATTGTCCCGACATTCGGCTGTCGCTGTCGCCGCACATCTGGCCCTGCAGTCTGCAGTGCAGACGGCGGTCTAATGAC
ACTGTCATTATGACCGGCAGCCAAGTCCTGAGGAAAGGGCGTCGGTGCGTGCGCATTGGAAAGCATCAGCGCTCCAGTGTCTGCCTCACCTCAGTGACGA
GGAAACTTCTTAGCCGAGCACGATACCAATAGAGTGGTTTCAGATGGCATCCCAAGCGTACCTGGAAGATATATCTGTTTCTGGTTTTGCGCTTCTCGCT
GCAATTGTATTCCGGCGCCTTCAATGAACGCAACATCAGTATCCAGCTGAGCAGCGTTAATCACGTTTGTATCAGCAGCATGTGCTGCATGGCAGCGGAC
ACTGCTTGGTGTCCCCTGGGATTCGCTCGCCGCACTAACGGTCCTTGGATGGACAGTCATGATAAAAATCGTGGTGAGACCAGCGCACCATTCTGGAGGT
GGATGACGGGCATGCTGCGGATCACCTGACGATGTGTTCAGGGCGCAACTACGGTCGAGAAAAGTGGTTTTGCGCTCTCTTATCCGAATGTTGGATCTGA
GCGCTTCTTATTCTTGGCTCACGCTGGCAGGCAAGATGCCACAGCATTCTCACCGTCGTTGGCATACAAATTGCAACGAGCCTTTGTTGGCGGGTGCTAC
CTAACTATCATCTGCTGTTTTGGCACCAATCGTCTGTTAGGTAGAATACTGTCAATTGCTCGCAAATGACCTAAATTGCATATTATCGACGTTCCACGTC
ATACCAGCCGCGCTTCGCGTGACTGTGGTTCGCTTCGCTCGCGATATGAAGATAGAACCTCGAGCCGCACGCATCGCCCTCACGCTTGAGGCTCCGGCGG
AGGGGGGGGGTTCTGTCCCTGCTTTCGCCGTGACGCTGCGGAAAAATAGTGTTTGGCGCTCAAACAGTCTTCGTGATAGCTTTCTCCTTCCCATTCTTAC
TCCTAACGTTAGTAGCAGACTGGTAGATAAAAAGAAGTAGTATTGACTATCTGTCGAAATGCAACAGGTAAGCAGGGGTTGCAACAGGCGATGGGATAAC
AGGTAGGCAGGGGCAAAGCAACAGGTATTAGTTATTTTCCCTTGTTGGCCATCACTGTCTACACGATTGATTTCGTTGCATCCTTAGCAACTATGCTTGC
GGTCTGCTGCCATGCGTGTCCTGACTCGGCTCCTCTGCATCGTCCATCACTTCATCTGCCTCCGCCCACACTGCAACGCAAAACAAACGATACCGGTAAC
ATGTCAAACTTCCGTCGCTGCATTCATCGTCACTACAGCAATACGCACCTGGTTTGTTGGATCCTAGCTTCGGCTTGTCAGGCTTGGCGATGGAGACACG
CAGCGTCCGCCCAAACAGCTCCGAATCTAATGATCACAGCCCTTTAGACACTGCCACACCACCATCCACAGACCACCATTAAGCATCCACCCACCGTCCA
TATTGTCAATAGCAGCTCTCGCATCCGCCTCGTCCTCGAACTCCACGAAACCGAAGCCTTTACTCCTCTCTGCTCCATCAGCCAGTTAGTCGTGCACATG
CCAGTATTACACCAACCCAACCCAATCGACGTACGCGTGGAGTATTCCGTGGGGATCTGCACAGACTTGACGGGGCCGAAGGGCACGAAGGCCGTGTACA
GCCCCTGCTCCGTCACTTGCTTGTCCAGGCCGCCCACGTACAGCGCCCGCTTGTCCGCCTTGCCCGCCATTCTGTCTTTTTAATGACCGGACTCTCCACT
AAGTACGACCTGATCTTTTCCGAAACGCCTATGCAGATTTCGAAAGCCGAGGAGGCGAAGCAAGTGAGCGCCTCGTTCCCAGCAGGATATCACCATGAGC
GCGGCCACGGACGAGCTGTTTAACCAAGGTGCGTGATAGAAGAGAGACGCCTAGGTGGACATGCGCAAGCCACGTTTCGTGCCTCGCCGTGGTTGCGGAG
AAATCGCGACGCAAAGTCAGCGCTTGGACTGATAATTGGACGTCTTTTTGCGACAGGTTGGGGCGACGTGCTGAGCAACATCTCGCCGTATGCGTGGGGC
AGCATGGGAGTAGCCTTCGGCTTGGCCTTCTCCATTGTTGGCGCCGCCTGGTGCGTCCTGCGTCTGATTCCTGAGGGTGGAAGAAGAGAGGCTTACTGTT
TTTACTACGTGGTGGCTGGCTGCACAGGGGCATCTTCATCACGGGGTCAAGTCTTCTGGGCGCTGCTGTGAAGGCCCCGCGCGTGCGATCCAAGAACCTC
GTGAGCATCATTTTCTGTGAAGCCACTGCCATCTACGGCGTCATTATCGCTATCATTCTGCAGAGCAAGGTGTGTTCTCATTGCTGCACTGAGAGCAGTG
TGGTTGTTATGTGGAGAGTGCTGATTGAGTGCGTGCTTAAATAACTGGGTAGATGAACCAACCGGCACTCCGTAACGAGGGGGATGAACCGATCAATGAA
CACGCGCTGTACTTCGCAGGATACGCCGTGTTCGGCTCGGGTCTTGCTGTTGGCTTGACGAACCTTGCCAGCGGGTACGATCTTCGCGTATAACTTTGTA
GCTTGTGGACGGGATGGTGAGACTCACCTGTTGCTTGGTGTAGAATTTCCGTCGGGATCGCTGGCAGCAGTTGCGTGCTTGCTGATGCACAGAATGCTGC
GCTGTATGTGACGATTTTGATTGTGGAGATTTTCGCTAGTGCGCTGGGCATCTTCGGTGTCATTGTCGGCATTATCCTTCCAACAACGCGGAGTTCCCTA
AGTAAGCAAAACTA