Description :
From Genome Similarity Track
Location :
scaffold_604:3462- 5263
Transcript NameFunction/comments
Pl_103509hypothetical protein PHYSODRAFT_524024

Sequence
1801 bases(100 bases per row)
GTGGTGGTGGTGGCGGTGGCGGTTGCCCGTATGCACCAGTCCGCTGAACTGAAGGAGGTATCCCTGGCGGAGGTGGCGGCGGGGGAATCGGCCCACCATG
ATCCCATCGTTGTACTGGAGGCCCTGGCGGTCCGGCAGGCGCCACGTGTGGTGGCTGGTGGTGAGGCACTGACACCTGTGGTGCAGGAGATACTTGAACC
ATGATATTGAGAATCAGAAGCGAATCAGAAGCGGTGACTCTGCTACAGGCATTGTCGCCATTTCGCTTAGTTCTCACGTCGTCACTGTCAGAAACTTCCA
TTGAGCTCTCTGACTTGACTGTCCGCGCTCTAGCACCCTTGGTTCCATTTTCTGGAGTTCCATCGCCGTTAACAAGTCCGTGCACATTTTCACTAGATCC
ATGGATAGAGACGATCTGCGCCATTCGCTGCTCATTTTGGGTCTCCAGCGACTGGCGCACCTGAAAATCTCGCTCGCGGCGCTTTCGAAGTGCGTCAGAA
CGTAATTTTTGCTCCGATTGACGACGTTTCACAAAGCTTTGAATGGGTGGAGGAGCTAGAAAGGTAGAACGCGCACGAGATTTCCTCTCGATATGATAGA
CAGCATTTTGTACCCGCAGCTGTTCATCGTATGACAGTCCATCACTATCAAAAAATGTCTTGTATCGCTTCGCTATTGTCAGTAGCAAGTCCGACGCTCC
ATCGCTGTCCCTCTGCTCTTCCGCTTTGTCGGCCCATTTAAGCGCCCGCTCGCGCTCAGATTCATATGCATTCCAATCGATTGCAGAAACGTCAGCCACC
GCCTGTGTCTCCTTTCTATCAGCACTTGATTCCTCGTCTCCACTGTCACTGTTTTCTGAAGCCAAGGAGCTCTCTCCGACAGCTTGGAGCTGTTTGCGAA
TTTTGGCATAGTCTGGGAAGTCTTCGTACTTAAGCGACTGTAGATAATCCATCATCTCCAGTAACTGGGTCGCACCTGGGAGACCCTCCACCAACAGACT
TGGATTCGTTTCAGTAAAGTGTTCCTTGAGACTAAGCACAGTCTGACGATTCTTCAGCTGTGCGTCACCAGCCCACGGCAATTCGCCACGCAAAAAGTCC
AGGACGAGATAAAACCACGACCATAGGTCATCCTTCGGGCCCAATTCTTGTCGACGATGCGAGCTTAGGGACGCGTACATGGACGTGCCACGAAATTCGG
CAGCCTGTCGTGCAGGTAGAACCTTTCGATCTTCACCAAGATGTTGTCTCGACAGTCCAAAGTCAATAATGTAATAGCGAGCCTGTTTCAACGGATTTCT
CTCTGGAACAGCGCTCAATGCGAAGTTGGATGCCTTGATGTCACGATGCACGTACCCATGTCGATGGAAGGCCTCAATGCAATCCAACATCTCCAGTCCG
ACCGAAACTGATTTGGCCAATGGTACTCCATGGATCGAGTCTGGTGACATTCTCAGCATCGACATGCTATCTCCCAAGAGCTCCATTACCAGCACGGTGC
TGTCTCCATGTTTGCCGTGATAATAGTATCTGCACACGTAGGGACAGTCCTGTAGACTCTTGAGGATCAAACTCTCCCACTCCAGCACAGGCTTGAGTGA
ACTTGGGGCTTCCACCTTCACTGCAACTTTATCTCGACTTTCGATCGAGTACGCCGAGTAGATTTGACTAAATGTACCCTGCATCACAACACAAAAGTTA
TGAAAAAGCAATGATAAAATAAATAAATCTCCCCAATCGTCTCACCTCTCCGATCTTTTCTCCAATTTTCCACTTCTCCGCTATCACTTCGCCAGCCTGT
T